Incidental Mutation 'R7872:Poli'
ID608210
Institutional Source Beutler Lab
Gene Symbol Poli
Ensembl Gene ENSMUSG00000038425
Gene Namepolymerase (DNA directed), iota
SynonymsRad30b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7872 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location70508680-70530620 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70522820 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 281 (L281P)
Ref Sequence ENSEMBL: ENSMUSP00000112563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043286] [ENSMUST00000121674] [ENSMUST00000159389] [ENSMUST00000160713] [ENSMUST00000161542]
Predicted Effect probably damaging
Transcript: ENSMUST00000043286
AA Change: L218P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039869
Gene: ENSMUSG00000038425
AA Change: L218P

DomainStartEndE-ValueType
Pfam:IMS 1 168 5.4e-39 PFAM
Pfam:IMS_HHH 180 212 1.2e-9 PFAM
Pfam:IMS_C 247 379 1.7e-12 PFAM
PDB:2KWV|A 444 489 8e-23 PDB
low complexity region 532 546 N/A INTRINSIC
PDB:3AI4|A 623 674 4e-26 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000121674
AA Change: L281P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112563
Gene: ENSMUSG00000038425
AA Change: L281P

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:IMS 53 231 1e-47 PFAM
Pfam:IMS_HHH 243 275 1.5e-9 PFAM
Pfam:IMS_C 312 441 2.5e-14 PFAM
PDB:2KWV|A 507 552 8e-23 PDB
low complexity region 595 609 N/A INTRINSIC
PDB:3AI4|A 686 737 5e-26 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000159389
AA Change: L195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123964
Gene: ENSMUSG00000038425
AA Change: L195P

DomainStartEndE-ValueType
Pfam:IMS 1 145 1.8e-29 PFAM
Pfam:IMS_HHH 157 189 1.7e-9 PFAM
Pfam:IMS_C 224 356 2.4e-12 PFAM
PDB:2KWV|A 421 466 7e-23 PDB
low complexity region 509 523 N/A INTRINSIC
PDB:3AI4|A 600 651 3e-26 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160713
SMART Domains Protein: ENSMUSP00000125467
Gene: ENSMUSG00000038425

DomainStartEndE-ValueType
Pfam:IMS 1 127 5.9e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161542
AA Change: L218P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124877
Gene: ENSMUSG00000038425
AA Change: L218P

DomainStartEndE-ValueType
Pfam:IMS 1 168 5.4e-39 PFAM
Pfam:IMS_HHH 180 212 1.2e-9 PFAM
Pfam:IMS_C 247 379 1.7e-12 PFAM
PDB:2KWV|A 444 489 8e-23 PDB
low complexity region 532 546 N/A INTRINSIC
PDB:3AI4|A 623 674 4e-26 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous mutation show normal somatic hypermutation of immunoglobulin variable genes and no significant increase in UV-induced epithelial skin tumor formation relative to controls; in contrast, formation of mesenchymal tumors by chronic UV irradiation is enhanced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,439 D290N probably damaging Het
Adam18 T C 8: 24,611,100 D682G probably benign Het
Ankrd46 A G 15: 36,485,843 V88A possibly damaging Het
Ankub1 T A 3: 57,665,386 K305I probably damaging Het
Atrn T A 2: 130,970,227 probably null Het
Bambi A T 18: 3,511,406 T76S probably benign Het
Cacna1a T A 8: 84,583,654 V1447E probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Clcn2 A G 16: 20,708,460 M629T probably damaging Het
Clcn4 T C 7: 7,287,781 N673S probably benign Het
Col20a1 T C 2: 180,986,578 F15S probably benign Het
Col2a1 G A 15: 98,000,577 Q39* probably null Het
Creb3 A G 4: 43,563,332 E119G probably benign Het
Dnah5 A C 15: 28,245,684 D556A probably damaging Het
Edar C T 10: 58,610,526 M192I possibly damaging Het
Fam91a1 A G 15: 58,448,360 M634V probably benign Het
Fbxo10 C T 4: 45,051,699 V471I not run Het
Fer1l5 T C 1: 36,421,886 F2032L probably benign Het
Gm5150 A C 3: 16,006,321 M1R probably null Het
Grin1 T C 2: 25,298,190 E509G probably benign Het
Igkv10-94 C T 6: 68,704,929 probably benign Het
Il18bp A G 7: 102,016,795 Y59H possibly damaging Het
Ints8 A T 4: 11,254,062 C17S probably benign Het
Kcnmb1 T C 11: 33,966,275 Y74H probably damaging Het
Kpna1 T C 16: 36,023,195 V313A probably benign Het
Lrp4 C T 2: 91,490,716 T1029I possibly damaging Het
Lrrc7 A T 3: 158,353,462 C3S probably damaging Het
Lyst C A 13: 13,635,865 H707N probably benign Het
Map3k20 A G 2: 72,371,754 K148R probably damaging Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mocs1 T A 17: 49,439,533 I177N probably damaging Het
Muc5b A G 7: 141,846,113 D441G unknown Het
Ncoa1 T C 12: 4,278,186 N884S probably benign Het
Olfr33 A G 7: 102,714,182 V77A probably benign Het
Olfr533 A G 7: 140,466,783 N194S probably damaging Het
Padi6 A T 4: 140,727,762 F621L probably damaging Het
Pde8b C A 13: 95,086,839 M197I possibly damaging Het
Pear1 T A 3: 87,752,215 I771L probably benign Het
Prdm12 T C 2: 31,640,219 W41R probably damaging Het
Prkdc T G 16: 15,715,006 S1500A probably benign Het
Prune2 T A 19: 17,119,434 H767Q probably benign Het
Rasgef1b G A 5: 99,234,544 Q196* probably null Het
Rnpc3 A T 3: 113,622,447 L121* probably null Het
Rpp14 A G 14: 8,083,724 M1V probably null Het
Ryr2 T A 13: 11,595,724 D4072V probably damaging Het
Sgms1 T C 19: 32,125,365 H314R probably damaging Het
Six4 CT C 12: 73,104,239 probably benign Het
Slc37a3 A T 6: 39,347,310 Y335N probably damaging Het
Tcp11l1 A T 2: 104,706,492 H9Q probably benign Het
Tnrc6a T A 7: 123,179,834 M1256K probably damaging Het
Trpc6 A G 9: 8,609,909 N126S probably damaging Het
Ubr4 T C 4: 139,393,062 F266S possibly damaging Het
Uimc1 A G 13: 55,069,737 V424A possibly damaging Het
Utrn T C 10: 12,698,129 I1066V probably benign Het
Vmn1r204 A G 13: 22,556,234 T12A probably benign Het
Vmn1r57 T A 7: 5,220,614 I46N possibly damaging Het
Vmn1r91 T C 7: 20,101,914 Y253H probably benign Het
Vmn2r14 T A 5: 109,221,353 H118L probably benign Het
Zcchc11 T G 4: 108,517,518 C933G probably damaging Het
Zfp775 A G 6: 48,620,470 K426R probably benign Het
Other mutations in Poli
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Poli APN 18 70525490 missense probably damaging 1.00
IGL01506:Poli APN 18 70509731 missense probably benign
IGL01958:Poli APN 18 70526586 missense possibly damaging 0.46
IGL02375:Poli APN 18 70523292 missense probably damaging 1.00
IGL02385:Poli APN 18 70526574 missense possibly damaging 0.93
IGL02480:Poli APN 18 70525406 missense probably benign 0.04
R0113:Poli UTSW 18 70528758 missense probably damaging 1.00
R0184:Poli UTSW 18 70522731 missense probably damaging 1.00
R0348:Poli UTSW 18 70523381 missense probably benign 0.00
R0710:Poli UTSW 18 70522890 splice site probably null
R1004:Poli UTSW 18 70525438 missense probably benign 0.31
R1264:Poli UTSW 18 70517503 missense probably benign 0.05
R1660:Poli UTSW 18 70509464 missense probably damaging 0.99
R1992:Poli UTSW 18 70508987 missense probably damaging 0.98
R2915:Poli UTSW 18 70522700 critical splice donor site probably null
R4531:Poli UTSW 18 70517477 missense probably benign 0.41
R4816:Poli UTSW 18 70522751 missense probably damaging 1.00
R5393:Poli UTSW 18 70517428 nonsense probably null
R5404:Poli UTSW 18 70509432 missense probably benign 0.15
R5559:Poli UTSW 18 70509285 missense probably benign 0.02
R5957:Poli UTSW 18 70517440 missense probably benign
R6045:Poli UTSW 18 70517469 missense possibly damaging 0.75
R6385:Poli UTSW 18 70530001 start gained probably benign
R6807:Poli UTSW 18 70530151 splice site probably null
R7024:Poli UTSW 18 70516849 missense possibly damaging 0.68
R7067:Poli UTSW 18 70509417 nonsense probably null
R7452:Poli UTSW 18 70508978 missense possibly damaging 0.94
R7653:Poli UTSW 18 70509627 missense probably benign
R7685:Poli UTSW 18 70525519 missense probably benign 0.13
R7857:Poli UTSW 18 70509154 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGATCACTCACAAGCTGC -3'
(R):5'- ACAAGACTTTGAGTGGTGCC -3'

Sequencing Primer
(F):5'- GGTGAACAGGAAAGCAGACATCTTC -3'
(R):5'- TGGTGCCCTGGAGCCATATG -3'
Posted On2019-12-20