Incidental Mutation 'R7873:Mdk'
ID608223
Institutional Source Beutler Lab
Gene Symbol Mdk
Ensembl Gene ENSMUSG00000027239
Gene Namemidkine
SynonymsMK, Mek
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7873 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location91929805-91932297 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91931428 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 7 (F7S)
Ref Sequence ENSEMBL: ENSMUSP00000028672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028667] [ENSMUST00000028672] [ENSMUST00000045537] [ENSMUST00000069423] [ENSMUST00000090602] [ENSMUST00000099709] [ENSMUST00000111303] [ENSMUST00000111309] [ENSMUST00000128152] [ENSMUST00000142231]
Predicted Effect probably benign
Transcript: ENSMUST00000028667
SMART Domains Protein: ENSMUSP00000028667
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
C1 96 153 2.67e-1 SMART
C1 173 231 8.18e-7 SMART
low complexity region 257 274 N/A INTRINSIC
DAGKc 296 420 4.61e-65 SMART
DAGKa 447 604 2.75e-95 SMART
low complexity region 762 780 N/A INTRINSIC
ANK 823 853 8.52e-4 SMART
ANK 858 887 2.18e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000028672
AA Change: F7S

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028672
Gene: ENSMUSG00000027239
AA Change: F7S

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
PTN 34 113 4.2e-53 SMART
low complexity region 120 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045537
SMART Domains Protein: ENSMUSP00000040808
Gene: ENSMUSG00000040495

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 42 248 5.7e-7 PFAM
Pfam:7tm_1 48 453 5.5e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069423
AA Change: F7S

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000068413
Gene: ENSMUSG00000027239
AA Change: F7S

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
PTN 34 113 4.2e-53 SMART
low complexity region 120 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090602
AA Change: F7S

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000088090
Gene: ENSMUSG00000027239
AA Change: F7S

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
PTN 34 113 4.2e-53 SMART
low complexity region 120 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099709
SMART Domains Protein: ENSMUSP00000106937
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 2 38 N/A INTRINSIC
low complexity region 83 92 N/A INTRINSIC
C1 113 170 2.67e-1 SMART
C1 190 248 8.18e-7 SMART
low complexity region 274 291 N/A INTRINSIC
DAGKc 313 437 4.61e-65 SMART
DAGKa 464 621 2.75e-95 SMART
low complexity region 779 797 N/A INTRINSIC
ANK 840 870 8.52e-4 SMART
ANK 875 904 2.18e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111303
SMART Domains Protein: ENSMUSP00000106934
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 39 58 N/A INTRINSIC
low complexity region 66 81 N/A INTRINSIC
low complexity region 100 113 N/A INTRINSIC
low complexity region 118 133 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
C1 290 347 2.67e-1 SMART
C1 367 425 8.18e-7 SMART
low complexity region 451 468 N/A INTRINSIC
DAGKc 490 614 4.61e-65 SMART
DAGKa 641 798 2.75e-95 SMART
low complexity region 956 974 N/A INTRINSIC
ANK 1017 1047 8.52e-4 SMART
ANK 1052 1081 2.18e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111309
AA Change: F7S

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106941
Gene: ENSMUSG00000027239
AA Change: F7S

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
PTN 34 113 4.2e-53 SMART
low complexity region 120 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128152
SMART Domains Protein: ENSMUSP00000118684
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 32 41 N/A INTRINSIC
Blast:C1 62 114 9e-33 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000142231
SMART Domains Protein: ENSMUSP00000114740
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted growth factor that belongs to the pleiotrophin/midkine heparin-binding protein family and functions in a variety of biological processes. The encoded cytokine promotes the growth, differentiation, survival and migration of several target cells including leucocytes involved in inflammation. This protein plays a role in the formation of scar tissue and intraperitoneal adhesions, and promotes neurite outgrowth and neuron survival. The protein encoded by this gene is associated with obesity and inhibition of insulin signaling in fat cells. A pseudogene of this gene is present on chromosome 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially normal except for some delayed development of the hippocampus and behavioral abnormalities when young. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,866,227 I229F probably benign Het
Abca14 T C 7: 120,289,569 L1246S probably benign Het
Acacb A C 5: 114,223,278 S1340R possibly damaging Het
Ankrd6 A T 4: 32,806,499 S585T possibly damaging Het
Btbd11 T C 10: 85,631,125 V685A possibly damaging Het
Ccdc54 A G 16: 50,590,309 V198A probably benign Het
Cnga4 A G 7: 105,407,042 I387V probably damaging Het
Creg1 G T 1: 165,769,879 D141Y probably damaging Het
Cxcr2 T C 1: 74,159,007 L220P probably benign Het
Dennd5a T A 7: 109,926,934 I344F probably damaging Het
Dysf A G 6: 84,083,765 N448S probably benign Het
Efcab6 A G 15: 84,018,625 probably null Het
Elf2 C A 3: 51,256,678 V489F probably damaging Het
Elmod2 G T 8: 83,331,219 H12N probably benign Het
Eln C T 5: 134,711,187 G618E unknown Het
Fam129c A T 8: 71,602,248 I193F probably damaging Het
Fbxo33 G T 12: 59,219,021 S153R possibly damaging Het
Fbxw7 A T 3: 84,925,764 I38F possibly damaging Het
Flnc G A 6: 29,456,991 V2329I possibly damaging Het
Fsip2 C T 2: 82,949,512 R201C probably damaging Het
Gm16486 A G 8: 70,711,340 M1061V probably benign Het
Gm5724 T A 6: 141,727,722 L363F probably benign Het
Gpr155 T C 2: 73,343,590 E825G possibly damaging Het
Grk3 A T 5: 112,929,686 M405K probably benign Het
Hace1 T C 10: 45,672,787 V597A possibly damaging Het
Hist1h2bf A T 13: 23,574,070 Y41N probably damaging Het
Ido1 A G 8: 24,584,742 F295S probably damaging Het
Ighe T A 12: 113,271,322 E406V Het
Ighv1-31 G T 12: 114,829,654 A15E probably benign Het
Ighv1-75 A T 12: 115,834,368 L10H probably damaging Het
Inpp5e T A 2: 26,407,945 K215* probably null Het
Krt18 C T 15: 102,030,956 T288I probably benign Het
Lrwd1 A T 5: 136,123,938 I490N probably benign Het
Macf1 T A 4: 123,504,551 probably null Het
Mapk8ip3 A G 17: 24,906,172 V482A probably benign Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Mycbp2 G A 14: 103,156,146 P2993L probably damaging Het
Nme4 A T 17: 26,093,888 Y99N probably damaging Het
Nr1d2 G A 14: 18,216,656 R171* probably null Het
Olfr63 A G 17: 33,269,374 I217V probably benign Het
Osgep G T 14: 50,915,890 T326K probably damaging Het
Pdgfd C T 9: 6,337,271 T201M probably benign Het
Pdk4 T C 6: 5,487,086 D320G probably benign Het
Pelp1 A T 11: 70,394,726 V772D probably damaging Het
Pkdrej T A 15: 85,816,523 R1737S probably benign Het
Ppp1r13b A T 12: 111,834,886 Y578N probably damaging Het
Ppp1r3b A C 8: 35,384,175 K56T probably benign Het
Prdm11 G T 2: 92,989,283 H261N probably benign Het
Preb T A 5: 30,958,765 N166I probably benign Het
Psd3 T C 8: 67,882,982 K681R possibly damaging Het
Ptgs1 G A 2: 36,251,280 V580I probably damaging Het
Ptpro T A 6: 137,430,739 S949T probably benign Het
Pum2 A G 12: 8,748,802 E973G possibly damaging Het
Rdh1 A G 10: 127,760,023 D29G probably benign Het
Rel A G 11: 23,742,957 S359P probably benign Het
Rnf165 T C 18: 77,466,753 D248G possibly damaging Het
Ryr3 T A 2: 112,730,428 H2996L probably benign Het
Scarb1 C T 5: 125,294,039 C323Y probably damaging Het
Scn5a C T 9: 119,498,127 R1309H probably damaging Het
Serpinb12 T A 1: 106,953,739 V202E probably damaging Het
Shh A G 5: 28,458,300 L290P possibly damaging Het
Six4 CT C 12: 73,104,239 probably benign Het
Slc34a2 G A 5: 53,058,372 G42R probably benign Het
Slc41a1 A G 1: 131,830,823 N68D possibly damaging Het
Slc7a6os A G 8: 106,210,724 S64P probably damaging Het
Smc1b A G 15: 85,110,650 probably null Het
Snx9 T C 17: 5,918,476 V349A possibly damaging Het
Sstr1 G T 12: 58,213,527 G312V probably damaging Het
Tnfsf10 A G 3: 27,335,659 I290V probably benign Het
Trio A G 15: 27,805,684 C1717R possibly damaging Het
Ttbk1 T G 17: 46,446,568 S1047R probably damaging Het
Ttn T C 2: 76,916,533 D4724G probably benign Het
Uba1y T A Y: 825,542 N301K probably benign Het
Unc5c A G 3: 141,827,549 T853A probably benign Het
Vmn2r45 T A 7: 8,483,075 I405L probably benign Het
Wdr37 A T 13: 8,805,933 M458K probably damaging Het
Zdhhc14 A T 17: 5,712,454 Y211F probably benign Het
Zfp108 G A 7: 24,261,333 V450I probably benign Het
Zfp212 A T 6: 47,930,926 R280* probably null Het
Zfp940 A T 7: 29,835,617 V108E unknown Het
Other mutations in Mdk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01932:Mdk APN 2 91931116 missense probably damaging 1.00
R5774:Mdk UTSW 2 91931224 missense probably damaging 0.96
R7182:Mdk UTSW 2 91930852 missense unknown
R8313:Mdk UTSW 2 91930833 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCTTCCAGTTGCAGGGCAC -3'
(R):5'- AGACATCGGTTCCAAGTCCTCC -3'

Sequencing Primer
(F):5'- TTGCAATGGACGCGCTG -3'
(R):5'- GGTTCCAAGTCCTCCCTCCG -3'
Posted On2019-12-20