Incidental Mutation 'R7873:Shh'
ID 608232
Institutional Source Beutler Lab
Gene Symbol Shh
Ensembl Gene ENSMUSG00000002633
Gene Name sonic hedgehog
Synonyms Hhg1
MMRRC Submission 045925-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7873 (G1)
Quality Score 106.008
Status Not validated
Chromosome 5
Chromosomal Location 28661838-28672099 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 28663298 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 290 (L290P)
Ref Sequence ENSEMBL: ENSMUSP00000002708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002708]
AlphaFold Q62226
PDB Structure A POTENTIAL CATALYTIC SITE WITHIN THE AMINO-TERMINAL SIGNALLING DOMAIN OF SONIC HEDGEHOG [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE COMPLEX BETWEEN HUMAN HEDGEHOG-INTERACTING PROTEIN HIP AND SONIC HEDGEHOG IN THE PRESENCE OF CALCIUM [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE COMPLEX BETWEEN HUMAN HEDGEHOG-INTERACTING PROTEIN HIP AND SONIC HEDGEHOG WITHOUT CALCIUM [X-RAY DIFFRACTION]
Crystal Structure of Sonic Hedgehog Bound to the third FNIII domain of CDO [X-RAY DIFFRACTION]
Crystal Structure of ShhN [X-RAY DIFFRACTION]
Crystal structure of the Sonic Hedgehog-chondroitin-4-sulphate complex [X-RAY DIFFRACTION]
Crystal structure of the Sonic Hedgehog-heparin complex [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002708
AA Change: L290P

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000002708
Gene: ENSMUSG00000002633
AA Change: L290P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:HH_signal 25 185 5.6e-92 PFAM
HintN 197 305 1.21e-30 SMART
HintC 310 355 4.58e-8 SMART
low complexity region 359 379 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is instrumental in patterning the early embryo. It has been implicated as the key inductive signal in patterning of the ventral neural tube, the anterior-posterior limb axis, and the ventral somites. Of three human proteins showing sequence and functional similarity to the sonic hedgehog protein of Drosophila, this protein is the most similar. The protein is made as a precursor that is autocatalytically cleaved; the N-terminal portion is soluble and contains the signalling activity while the C-terminal portion is involved in precursor processing. More importantly, the C-terminal product covalently attaches a cholesterol moiety to the N-terminal product, restricting the N-terminal product to the cell surface and preventing it from freely diffusing throughout the developing embryo. Defects in this protein or in its signalling pathway are a cause of holoprosencephaly (HPE), a disorder in which the developing forebrain fails to correctly separate into right and left hemispheres. HPE is manifested by facial deformities. It is also thought that mutations in this gene or in its signalling pathway may be responsible for VACTERL syndrome, which is characterized by vertebral defects, anal atresia, tracheoesophageal fistula with esophageal atresia, radial and renal dysplasia, cardiac anomalies, and limb abnormalities. Additionally, mutations in a long range enhancer located approximately 1 megabase upstream of this gene disrupt limb patterning and can result in preaxial polydactyly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Heterozygotes exhibit shortening of all digits, holes between the frontal bones, dyssymphyses between cervical vertebrae and bony plates over many ribs. Homozygotes usually die before E12, are short-limbed dwarfs and lack forefeet, hindfeet, eyes, ears, external genitalia and a mouth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,684,091 (GRCm39) I229F probably benign Het
Abca14 T C 7: 119,888,792 (GRCm39) L1246S probably benign Het
Abtb3 T C 10: 85,466,989 (GRCm39) V685A possibly damaging Het
Acacb A C 5: 114,361,339 (GRCm39) S1340R possibly damaging Het
Ankrd6 A T 4: 32,806,499 (GRCm39) S585T possibly damaging Het
Ark2c T C 18: 77,554,449 (GRCm39) D248G possibly damaging Het
Ccdc54 A G 16: 50,410,672 (GRCm39) V198A probably benign Het
Cnga4 A G 7: 105,056,249 (GRCm39) I387V probably damaging Het
Creg1 G T 1: 165,597,448 (GRCm39) D141Y probably damaging Het
Cxcr2 T C 1: 74,198,166 (GRCm39) L220P probably benign Het
Dennd5a T A 7: 109,526,141 (GRCm39) I344F probably damaging Het
Dysf A G 6: 84,060,747 (GRCm39) N448S probably benign Het
Efcab6 A G 15: 83,902,826 (GRCm39) probably null Het
Elf2 C A 3: 51,164,099 (GRCm39) V489F probably damaging Het
Elmod2 G T 8: 84,057,848 (GRCm39) H12N probably benign Het
Eln C T 5: 134,740,041 (GRCm39) G618E unknown Het
Fbxo33 G T 12: 59,265,807 (GRCm39) S153R possibly damaging Het
Fbxw7 A T 3: 84,833,071 (GRCm39) I38F possibly damaging Het
Flnc G A 6: 29,456,990 (GRCm39) V2329I possibly damaging Het
Fsip2 C T 2: 82,779,856 (GRCm39) R201C probably damaging Het
Gpr155 T C 2: 73,173,934 (GRCm39) E825G possibly damaging Het
Grk3 A T 5: 113,077,552 (GRCm39) M405K probably benign Het
H2bc7 A T 13: 23,758,244 (GRCm39) Y41N probably damaging Het
Hace1 T C 10: 45,548,883 (GRCm39) V597A possibly damaging Het
Ido1 A G 8: 25,074,758 (GRCm39) F295S probably damaging Het
Ighe T A 12: 113,234,942 (GRCm39) E406V Het
Ighv1-31 G T 12: 114,793,274 (GRCm39) A15E probably benign Het
Ighv1-75 A T 12: 115,797,988 (GRCm39) L10H probably damaging Het
Inpp5e T A 2: 26,297,957 (GRCm39) K215* probably null Het
Iqcn A G 8: 71,163,989 (GRCm39) M1061V probably benign Het
Krt18 C T 15: 101,939,391 (GRCm39) T288I probably benign Het
Lrwd1 A T 5: 136,152,792 (GRCm39) I490N probably benign Het
Macf1 T A 4: 123,398,344 (GRCm39) probably null Het
Mapk8ip3 A G 17: 25,125,146 (GRCm39) V482A probably benign Het
Mcidas G A 13: 113,135,521 (GRCm39) G315S probably damaging Het
Mdk A G 2: 91,761,773 (GRCm39) F7S probably benign Het
Mycbp2 G A 14: 103,393,582 (GRCm39) P2993L probably damaging Het
Niban3 A T 8: 72,054,892 (GRCm39) I193F probably damaging Het
Nme4 A T 17: 26,312,862 (GRCm39) Y99N probably damaging Het
Nr1d2 G A 14: 18,216,656 (GRCm38) R171* probably null Het
Or10h28 A G 17: 33,488,348 (GRCm39) I217V probably benign Het
Osgep G T 14: 51,153,347 (GRCm39) T326K probably damaging Het
Pdgfd C T 9: 6,337,271 (GRCm39) T201M probably benign Het
Pdk4 T C 6: 5,487,086 (GRCm39) D320G probably benign Het
Pelp1 A T 11: 70,285,552 (GRCm39) V772D probably damaging Het
Pkdrej T A 15: 85,700,724 (GRCm39) R1737S probably benign Het
Ppp1r13b A T 12: 111,801,320 (GRCm39) Y578N probably damaging Het
Ppp1r3b A C 8: 35,851,329 (GRCm39) K56T probably benign Het
Prdm11 G T 2: 92,819,628 (GRCm39) H261N probably benign Het
Preb T A 5: 31,116,109 (GRCm39) N166I probably benign Het
Psd3 T C 8: 68,335,634 (GRCm39) K681R possibly damaging Het
Ptgs1 G A 2: 36,141,292 (GRCm39) V580I probably damaging Het
Ptpro T A 6: 137,407,737 (GRCm39) S949T probably benign Het
Pum2 A G 12: 8,798,802 (GRCm39) E973G possibly damaging Het
Rdh1 A G 10: 127,595,892 (GRCm39) D29G probably benign Het
Rel A G 11: 23,692,957 (GRCm39) S359P probably benign Het
Ryr3 T A 2: 112,560,773 (GRCm39) H2996L probably benign Het
Scarb1 C T 5: 125,371,103 (GRCm39) C323Y probably damaging Het
Scn5a C T 9: 119,327,193 (GRCm39) R1309H probably damaging Het
Serpinb12 T A 1: 106,881,469 (GRCm39) V202E probably damaging Het
Six4 CT C 12: 73,151,013 (GRCm39) probably benign Het
Slc34a2 G A 5: 53,215,714 (GRCm39) G42R probably benign Het
Slc41a1 A G 1: 131,758,561 (GRCm39) N68D possibly damaging Het
Slc7a6os A G 8: 106,937,356 (GRCm39) S64P probably damaging Het
Slco1a7 T A 6: 141,673,448 (GRCm39) L363F probably benign Het
Smc1b A G 15: 84,994,851 (GRCm39) probably null Het
Snx9 T C 17: 5,968,751 (GRCm39) V349A possibly damaging Het
Sstr1 G T 12: 58,260,313 (GRCm39) G312V probably damaging Het
Tnfsf10 A G 3: 27,389,808 (GRCm39) I290V probably benign Het
Trio A G 15: 27,805,770 (GRCm39) C1717R possibly damaging Het
Ttbk1 T G 17: 46,757,494 (GRCm39) S1047R probably damaging Het
Ttn T C 2: 76,746,877 (GRCm39) D4724G probably benign Het
Uba1y T A Y: 825,542 (GRCm39) N301K probably benign Het
Unc5c A G 3: 141,533,310 (GRCm39) T853A probably benign Het
Vmn2r45 T A 7: 8,486,074 (GRCm39) I405L probably benign Het
Wdr37 A T 13: 8,855,969 (GRCm39) M458K probably damaging Het
Zdhhc14 A T 17: 5,762,729 (GRCm39) Y211F probably benign Het
Zfp108 G A 7: 23,960,758 (GRCm39) V450I probably benign Het
Zfp212 A T 6: 47,907,860 (GRCm39) R280* probably null Het
Zfp940 A T 7: 29,535,042 (GRCm39) V108E unknown Het
Other mutations in Shh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03066:Shh APN 5 28,666,369 (GRCm39) missense probably damaging 1.00
BB005:Shh UTSW 5 28,666,404 (GRCm39) missense possibly damaging 0.88
BB015:Shh UTSW 5 28,666,404 (GRCm39) missense possibly damaging 0.88
R2484:Shh UTSW 5 28,671,740 (GRCm39) missense probably benign 0.22
R4153:Shh UTSW 5 28,662,947 (GRCm39) missense probably damaging 1.00
R4352:Shh UTSW 5 28,663,187 (GRCm39) missense probably benign
R4668:Shh UTSW 5 28,662,853 (GRCm39) makesense probably null
R5371:Shh UTSW 5 28,671,688 (GRCm39) missense probably damaging 1.00
R5407:Shh UTSW 5 28,671,578 (GRCm39) nonsense probably null
R6035:Shh UTSW 5 28,666,397 (GRCm39) missense probably damaging 1.00
R6035:Shh UTSW 5 28,666,397 (GRCm39) missense probably damaging 1.00
R7650:Shh UTSW 5 28,663,304 (GRCm39) missense probably benign 0.01
R7762:Shh UTSW 5 28,671,664 (GRCm39) missense probably benign 0.00
R7928:Shh UTSW 5 28,666,404 (GRCm39) missense possibly damaging 0.88
R8682:Shh UTSW 5 28,663,058 (GRCm39) missense probably benign 0.00
R8767:Shh UTSW 5 28,671,487 (GRCm39) missense possibly damaging 0.94
R8827:Shh UTSW 5 28,663,125 (GRCm39) missense probably damaging 1.00
R9300:Shh UTSW 5 28,663,461 (GRCm39) missense probably damaging 1.00
X0019:Shh UTSW 5 28,666,538 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCCGGTTGATGAGAATGG -3'
(R):5'- TCTACTCCGCAGAGAACTCC -3'

Sequencing Primer
(F):5'- ATGAGAATGGTGCCGTGC -3'
(R):5'- AAATCCGGCGGCTGTTTC -3'
Posted On 2019-12-20