Mutagenetix > Incidental Mutation

Incidental Mutation 'R7873:Acacb'

608236

Institutional Source

Beutler Lab

Gene Symbol

Acacb

Ensembl Gene

ENSMUSG00000042010

Gene Name

acetyl-Coenzyme A carboxylase beta

Synonyms

Acc2, Accb

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7873 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

114146535-114250761 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 114223278 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 1340 (S1340R)

Ref Sequence

ENSEMBL: ENSMUSP00000031583 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]

AlphaFold

E9Q4Z2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031583
AA Change: S1340R

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: S1340R

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	2.1e-32	PFAM
Pfam:CPSase_L_D2	405	606	3.3e-52	PFAM
Pfam:ATP-grasp_4	413	576	2.1e-9	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	1.9e-17	PFAM
Pfam:ACC_central	952	1678	2.2e-290	PFAM
Pfam:Carboxyl_trans	1770	2324	2.3e-181	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102582
AA Change: S1340R

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: S1340R

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	8.2e-29	PFAM
Pfam:CPSase_L_D2	405	606	3.8e-52	PFAM
Pfam:ATP-grasp_4	409	576	1.4e-12	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	9.1e-17	PFAM
Pfam:ACC_central	952	1678	2.3e-250	PFAM
Pfam:Carboxyl_trans	1770	2324	4.8e-172	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	A	T	16: 4,866,227	I229F	probably benign	Het
Abca14	T	C	7: 120,289,569	L1246S	probably benign	Het
Ankrd6	A	T	4: 32,806,499	S585T	possibly damaging	Het
Btbd11	T	C	10: 85,631,125	V685A	possibly damaging	Het
Ccdc54	A	G	16: 50,590,309	V198A	probably benign	Het
Cnga4	A	G	7: 105,407,042	I387V	probably damaging	Het
Creg1	G	T	1: 165,769,879	D141Y	probably damaging	Het
Cxcr2	T	C	1: 74,159,007	L220P	probably benign	Het
Dennd5a	T	A	7: 109,926,934	I344F	probably damaging	Het
Dysf	A	G	6: 84,083,765	N448S	probably benign	Het
Efcab6	A	G	15: 84,018,625		probably null	Het
Elf2	C	A	3: 51,256,678	V489F	probably damaging	Het
Elmod2	G	T	8: 83,331,219	H12N	probably benign	Het
Eln	C	T	5: 134,711,187	G618E	unknown	Het
Fam129c	A	T	8: 71,602,248	I193F	probably damaging	Het
Fbxo33	G	T	12: 59,219,021	S153R	possibly damaging	Het
Fbxw7	A	T	3: 84,925,764	I38F	possibly damaging	Het
Flnc	G	A	6: 29,456,991	V2329I	possibly damaging	Het
Fsip2	C	T	2: 82,949,512	R201C	probably damaging	Het
Gm16486	A	G	8: 70,711,340	M1061V	probably benign	Het
Gm5724	T	A	6: 141,727,722	L363F	probably benign	Het
Gpr155	T	C	2: 73,343,590	E825G	possibly damaging	Het
Grk3	A	T	5: 112,929,686	M405K	probably benign	Het
Hace1	T	C	10: 45,672,787	V597A	possibly damaging	Het
Hist1h2bf	A	T	13: 23,574,070	Y41N	probably damaging	Het
Ido1	A	G	8: 24,584,742	F295S	probably damaging	Het
Ighe	T	A	12: 113,271,322	E406V		Het
Ighv1-31	G	T	12: 114,829,654	A15E	probably benign	Het
Ighv1-75	A	T	12: 115,834,368	L10H	probably damaging	Het
Inpp5e	T	A	2: 26,407,945	K215*	probably null	Het
Krt18	C	T	15: 102,030,956	T288I	probably benign	Het
Lrwd1	A	T	5: 136,123,938	I490N	probably benign	Het
Macf1	T	A	4: 123,504,551		probably null	Het
Mapk8ip3	A	G	17: 24,906,172	V482A	probably benign	Het
Mcidas	G	A	13: 112,998,987	G315S	probably damaging	Het
Mdk	A	G	2: 91,931,428	F7S	probably benign	Het
Mycbp2	G	A	14: 103,156,146	P2993L	probably damaging	Het
Nme4	A	T	17: 26,093,888	Y99N	probably damaging	Het
Nr1d2	G	A	14: 18,216,656	R171*	probably null	Het
Olfr63	A	G	17: 33,269,374	I217V	probably benign	Het
Osgep	G	T	14: 50,915,890	T326K	probably damaging	Het
Pdgfd	C	T	9: 6,337,271	T201M	probably benign	Het
Pdk4	T	C	6: 5,487,086	D320G	probably benign	Het
Pelp1	A	T	11: 70,394,726	V772D	probably damaging	Het
Pkdrej	T	A	15: 85,816,523	R1737S	probably benign	Het
Ppp1r13b	A	T	12: 111,834,886	Y578N	probably damaging	Het
Ppp1r3b	A	C	8: 35,384,175	K56T	probably benign	Het
Prdm11	G	T	2: 92,989,283	H261N	probably benign	Het
Preb	T	A	5: 30,958,765	N166I	probably benign	Het
Psd3	T	C	8: 67,882,982	K681R	possibly damaging	Het
Ptgs1	G	A	2: 36,251,280	V580I	probably damaging	Het
Ptpro	T	A	6: 137,430,739	S949T	probably benign	Het
Pum2	A	G	12: 8,748,802	E973G	possibly damaging	Het
Rdh1	A	G	10: 127,760,023	D29G	probably benign	Het
Rel	A	G	11: 23,742,957	S359P	probably benign	Het
Rnf165	T	C	18: 77,466,753	D248G	possibly damaging	Het
Ryr3	T	A	2: 112,730,428	H2996L	probably benign	Het
Scarb1	C	T	5: 125,294,039	C323Y	probably damaging	Het
Scn5a	C	T	9: 119,498,127	R1309H	probably damaging	Het
Serpinb12	T	A	1: 106,953,739	V202E	probably damaging	Het
Shh	A	G	5: 28,458,300	L290P	possibly damaging	Het
Six4	CT	C	12: 73,104,239		probably benign	Het
Slc34a2	G	A	5: 53,058,372	G42R	probably benign	Het
Slc41a1	A	G	1: 131,830,823	N68D	possibly damaging	Het
Slc7a6os	A	G	8: 106,210,724	S64P	probably damaging	Het
Smc1b	A	G	15: 85,110,650		probably null	Het
Snx9	T	C	17: 5,918,476	V349A	possibly damaging	Het
Sstr1	G	T	12: 58,213,527	G312V	probably damaging	Het
Tnfsf10	A	G	3: 27,335,659	I290V	probably benign	Het
Trio	A	G	15: 27,805,684	C1717R	possibly damaging	Het
Ttbk1	T	G	17: 46,446,568	S1047R	probably damaging	Het
Ttn	T	C	2: 76,916,533	D4724G	probably benign	Het
Uba1y	T	A	Y: 825,542	N301K	probably benign	Het
Unc5c	A	G	3: 141,827,549	T853A	probably benign	Het
Vmn2r45	T	A	7: 8,483,075	I405L	probably benign	Het
Wdr37	A	T	13: 8,805,933	M458K	probably damaging	Het
Zdhhc14	A	T	17: 5,712,454	Y211F	probably benign	Het
Zfp108	G	A	7: 24,261,333	V450I	probably benign	Het
Zfp212	A	T	6: 47,930,926	R280*	probably null	Het
Zfp940	A	T	7: 29,835,617	V108E	unknown	Het

Other mutations in Acacb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Acacb	APN	5	114200289	missense	probably damaging	1.00
IGL01291:Acacb	APN	5	114225870	missense	probably benign	0.03
IGL01301:Acacb	APN	5	114246498	missense	probably benign
IGL01633:Acacb	APN	5	114218858	splice site	probably benign
IGL01736:Acacb	APN	5	114188442	missense	possibly damaging	0.96
IGL01782:Acacb	APN	5	114200520	missense	probably damaging	1.00
IGL01924:Acacb	APN	5	114223986	splice site	probably benign
IGL01933:Acacb	APN	5	114184190	splice site	probably benign
IGL02028:Acacb	APN	5	114166015	missense	probably damaging	1.00
IGL02045:Acacb	APN	5	114240660	missense	possibly damaging	0.95
IGL02346:Acacb	APN	5	114238699	missense	probably damaging	1.00
IGL02421:Acacb	APN	5	114223878	missense	probably benign	0.00
IGL02445:Acacb	APN	5	114245137	missense	probably damaging	1.00
IGL02491:Acacb	APN	5	114192105	missense	probably damaging	1.00
IGL02598:Acacb	APN	5	114246037	missense	probably damaging	1.00
IGL02700:Acacb	APN	5	114218881	missense	probably damaging	1.00
IGL02730:Acacb	APN	5	114166149	splice site	probably benign
IGL03110:Acacb	APN	5	114195234	missense	probably damaging	0.96
IGL03125:Acacb	APN	5	114204805	missense	possibly damaging	0.49
IGL03263:Acacb	APN	5	114213693	missense	probably damaging	1.00
IGL03324:Acacb	APN	5	114225854	nonsense	probably null
acetone	UTSW	5	114226857	nonsense	probably null
anabolism	UTSW	5	114245220	missense	possibly damaging	0.63
ANU05:Acacb	UTSW	5	114225870	missense	probably benign	0.03
ANU18:Acacb	UTSW	5	114246498	missense	probably benign
BB001:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
BB011:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
I0000:Acacb	UTSW	5	114238655	missense	probably damaging	0.99
R0001:Acacb	UTSW	5	114204833	splice site	probably benign
R0219:Acacb	UTSW	5	114232944	missense	possibly damaging	0.79
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0278:Acacb	UTSW	5	114233259	nonsense	probably null
R0607:Acacb	UTSW	5	114200301	missense	probably damaging	1.00
R0964:Acacb	UTSW	5	114229752	missense	possibly damaging	0.64
R1116:Acacb	UTSW	5	114210956	missense	probably damaging	1.00
R1196:Acacb	UTSW	5	114245092	missense	probably benign	0.00
R1204:Acacb	UTSW	5	114190153	missense	probably damaging	1.00
R1387:Acacb	UTSW	5	114200512	missense	probably benign
R1415:Acacb	UTSW	5	114165921	missense	probably benign
R1475:Acacb	UTSW	5	114195252	missense	possibly damaging	0.87
R1497:Acacb	UTSW	5	114196807	missense	probably damaging	1.00
R1520:Acacb	UTSW	5	114201940	missense	possibly damaging	0.67
R1591:Acacb	UTSW	5	114203423	missense	possibly damaging	0.87
R1644:Acacb	UTSW	5	114195285	missense	probably damaging	1.00
R1732:Acacb	UTSW	5	114190087	missense	possibly damaging	0.63
R1783:Acacb	UTSW	5	114209767	frame shift	probably null
R1784:Acacb	UTSW	5	114209767	frame shift	probably null
R1834:Acacb	UTSW	5	114235475	missense	probably damaging	1.00
R1858:Acacb	UTSW	5	114196709	missense	probably benign	0.13
R1886:Acacb	UTSW	5	114218959	missense	probably damaging	1.00
R1901:Acacb	UTSW	5	114165734	nonsense	probably null
R1902:Acacb	UTSW	5	114165734	nonsense	probably null
R1903:Acacb	UTSW	5	114165734	nonsense	probably null
R1924:Acacb	UTSW	5	114230720	missense	possibly damaging	0.67
R1934:Acacb	UTSW	5	114198282	missense	probably benign	0.27
R2051:Acacb	UTSW	5	114245890	missense	probably damaging	1.00
R2132:Acacb	UTSW	5	114209767	frame shift	probably null
R2133:Acacb	UTSW	5	114209767	frame shift	probably null
R2260:Acacb	UTSW	5	114216917	missense	probably damaging	0.99
R2967:Acacb	UTSW	5	114166070	missense	possibly damaging	0.81
R3421:Acacb	UTSW	5	114212636	splice site	probably null
R3729:Acacb	UTSW	5	114207348	missense	probably damaging	0.99
R4206:Acacb	UTSW	5	114213651	missense	probably benign
R4245:Acacb	UTSW	5	114230784	missense	probably damaging	0.97
R4386:Acacb	UTSW	5	114241921	critical splice acceptor site	probably null
R4439:Acacb	UTSW	5	114246496	missense	possibly damaging	0.50
R4577:Acacb	UTSW	5	114226831	missense	probably damaging	1.00
R4658:Acacb	UTSW	5	114200564	missense	probably damaging	0.96
R4688:Acacb	UTSW	5	114204763	missense	probably benign	0.01
R4720:Acacb	UTSW	5	114229914	missense	possibly damaging	0.73
R4898:Acacb	UTSW	5	114232938	missense	probably benign	0.04
R5044:Acacb	UTSW	5	114166027	missense	probably benign	0.03
R5070:Acacb	UTSW	5	114246028	missense	possibly damaging	0.46
R5294:Acacb	UTSW	5	114241952	missense	probably damaging	1.00
R5350:Acacb	UTSW	5	114244551	missense	probably damaging	1.00
R5401:Acacb	UTSW	5	114209853	missense	possibly damaging	0.80
R5531:Acacb	UTSW	5	114204706	missense	possibly damaging	0.92
R5542:Acacb	UTSW	5	114195737	missense	probably damaging	1.00
R5751:Acacb	UTSW	5	114230832	missense	possibly damaging	0.79
R5821:Acacb	UTSW	5	114184106	missense	possibly damaging	0.69
R5893:Acacb	UTSW	5	114229851	missense	probably benign	0.01
R5911:Acacb	UTSW	5	114232890	missense	probably damaging	0.97
R5944:Acacb	UTSW	5	114245980	missense	probably damaging	1.00
R5973:Acacb	UTSW	5	114226867	missense	probably damaging	1.00
R6027:Acacb	UTSW	5	114165600	missense	probably benign	0.43
R6103:Acacb	UTSW	5	114245881	missense	probably damaging	1.00
R6139:Acacb	UTSW	5	114212652	missense	probably damaging	1.00
R6292:Acacb	UTSW	5	114200251	missense	probably damaging	1.00
R6368:Acacb	UTSW	5	114216823	missense	probably damaging	0.98
R6429:Acacb	UTSW	5	114228591	missense	probably damaging	1.00
R6942:Acacb	UTSW	5	114191963	critical splice donor site	probably null
R7138:Acacb	UTSW	5	114207326	missense	probably benign	0.12
R7241:Acacb	UTSW	5	114245100	missense	possibly damaging	0.94
R7254:Acacb	UTSW	5	114209751	critical splice acceptor site	probably null
R7396:Acacb	UTSW	5	114213661	missense	possibly damaging	0.87
R7439:Acacb	UTSW	5	114195642	missense	possibly damaging	0.84
R7484:Acacb	UTSW	5	114218862	missense	probably damaging	1.00
R7585:Acacb	UTSW	5	114246012	missense	probably damaging	0.99
R7712:Acacb	UTSW	5	114165738	missense	probably benign	0.13
R7868:Acacb	UTSW	5	114248227	missense	probably benign	0.22
R7924:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
R7940:Acacb	UTSW	5	114166047	missense	possibly damaging	0.77
R7951:Acacb	UTSW	5	114188340	missense	probably damaging	1.00
R7960:Acacb	UTSW	5	114230861	missense	probably benign	0.00
R7972:Acacb	UTSW	5	114226857	nonsense	probably null
R8007:Acacb	UTSW	5	114218874	missense	probably damaging	0.97
R8022:Acacb	UTSW	5	114223854	missense	probably benign
R8030:Acacb	UTSW	5	114233167	missense	probably damaging	1.00
R8241:Acacb	UTSW	5	114195236	missense	possibly damaging	0.49
R8264:Acacb	UTSW	5	114207366	missense	probably benign	0.00
R8292:Acacb	UTSW	5	114200494	critical splice acceptor site	probably null
R8678:Acacb	UTSW	5	114201971	nonsense	probably null
R8693:Acacb	UTSW	5	114226783	missense	probably damaging	0.99
R8697:Acacb	UTSW	5	114213380	missense	probably damaging	0.96
R8772:Acacb	UTSW	5	114184118	missense	possibly damaging	0.73
R8918:Acacb	UTSW	5	114195254	missense	probably damaging	1.00
R9008:Acacb	UTSW	5	114248754	splice site	silent
R9044:Acacb	UTSW	5	114235517	missense	probably benign	0.00
R9165:Acacb	UTSW	5	114216683	missense	probably benign	0.01
R9231:Acacb	UTSW	5	114211092	missense	probably benign	0.01
R9440:Acacb	UTSW	5	114246024	missense	possibly damaging	0.56
R9444:Acacb	UTSW	5	114245959	missense	probably damaging	0.99
R9562:Acacb	UTSW	5	114233336	missense	probably damaging	0.99
R9794:Acacb	UTSW	5	114249517	missense	probably benign	0.00
V1662:Acacb	UTSW	5	114238708	missense	probably damaging	1.00
Z1176:Acacb	UTSW	5	114248948	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AGACCCTACCTATCTACGGAAG -3'
(R):5'- CTGTAATTCTTAACTGCGGTGC -3'

Sequencing Primer
(F):5'- ACGGAAGCATCTTATCCTGATCTGG -3'
(R):5'- TGCCCGAATCTGGGTCTC -3'

Posted On

2019-12-20