Incidental Mutation 'R7873:Eln'
ID608238
Institutional Source Beutler Lab
Gene Symbol Eln
Ensembl Gene ENSMUSG00000029675
Gene Nameelastin
SynonymsE030024M20Rik, tropoelastin
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_007925.3; MGI:95317

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7873 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location134702593-134747323 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 134711187 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 618 (G618E)
Ref Sequence ENSEMBL: ENSMUSP00000015138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015138] [ENSMUST00000201856]
Predicted Effect unknown
Transcript: ENSMUST00000015138
AA Change: G618E
SMART Domains Protein: ENSMUSP00000015138
Gene: ENSMUSG00000029675
AA Change: G618E

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 183 220 N/A INTRINSIC
low complexity region 224 264 N/A INTRINSIC
low complexity region 292 301 N/A INTRINSIC
low complexity region 312 446 N/A INTRINSIC
low complexity region 451 798 N/A INTRINSIC
low complexity region 818 849 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201856
SMART Domains Protein: ENSMUSP00000144555
Gene: ENSMUSG00000029675

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 183 220 N/A INTRINSIC
SCOP:d1iq0a2 227 280 8e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype Strain: 2153007
Lethality: 3- 4
FUNCTION: This gene encodes elastin, the extracellular matrix protein that forms a major structural component of several tissues including lungs and arterial walls. Cleavage of the signal peptide from the encoded precursor generates soluble tropoelastin which undergoes lysine-derived crosslinking to form elastin polymers. Mice lacking the encoded protein exhibit defective lung development, and die of an obstructive arterial disease resulting from subendothelial cell proliferation and reorganization of smooth muscle. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for null allele die in the early postnatal period of an obstructive arterial disease. They exhibit a decrease in arterial diameter due to subendothelial accumulation of arterial smooth muscle, and display defective terminal airway development resulting in emphysematous morphology. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,866,227 I229F probably benign Het
Abca14 T C 7: 120,289,569 L1246S probably benign Het
Acacb A C 5: 114,223,278 S1340R possibly damaging Het
Ankrd6 A T 4: 32,806,499 S585T possibly damaging Het
Btbd11 T C 10: 85,631,125 V685A possibly damaging Het
Ccdc54 A G 16: 50,590,309 V198A probably benign Het
Cnga4 A G 7: 105,407,042 I387V probably damaging Het
Creg1 G T 1: 165,769,879 D141Y probably damaging Het
Cxcr2 T C 1: 74,159,007 L220P probably benign Het
Dennd5a T A 7: 109,926,934 I344F probably damaging Het
Dysf A G 6: 84,083,765 N448S probably benign Het
Efcab6 A G 15: 84,018,625 probably null Het
Elf2 C A 3: 51,256,678 V489F probably damaging Het
Elmod2 G T 8: 83,331,219 H12N probably benign Het
Fam129c A T 8: 71,602,248 I193F probably damaging Het
Fbxo33 G T 12: 59,219,021 S153R possibly damaging Het
Fbxw7 A T 3: 84,925,764 I38F possibly damaging Het
Flnc G A 6: 29,456,991 V2329I possibly damaging Het
Fsip2 C T 2: 82,949,512 R201C probably damaging Het
Gm16486 A G 8: 70,711,340 M1061V probably benign Het
Gm5724 T A 6: 141,727,722 L363F probably benign Het
Gpr155 T C 2: 73,343,590 E825G possibly damaging Het
Grk3 A T 5: 112,929,686 M405K probably benign Het
Hace1 T C 10: 45,672,787 V597A possibly damaging Het
Hist1h2bf A T 13: 23,574,070 Y41N probably damaging Het
Ido1 A G 8: 24,584,742 F295S probably damaging Het
Ighe T A 12: 113,271,322 E406V Het
Ighv1-31 G T 12: 114,829,654 A15E probably benign Het
Ighv1-75 A T 12: 115,834,368 L10H probably damaging Het
Inpp5e T A 2: 26,407,945 K215* probably null Het
Krt18 C T 15: 102,030,956 T288I probably benign Het
Lrwd1 A T 5: 136,123,938 I490N probably benign Het
Macf1 T A 4: 123,504,551 probably null Het
Mapk8ip3 A G 17: 24,906,172 V482A probably benign Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Mdk A G 2: 91,931,428 F7S probably benign Het
Mycbp2 G A 14: 103,156,146 P2993L probably damaging Het
Nme4 A T 17: 26,093,888 Y99N probably damaging Het
Nr1d2 G A 14: 18,216,656 R171* probably null Het
Olfr63 A G 17: 33,269,374 I217V probably benign Het
Osgep G T 14: 50,915,890 T326K probably damaging Het
Pdgfd C T 9: 6,337,271 T201M probably benign Het
Pdk4 T C 6: 5,487,086 D320G probably benign Het
Pelp1 A T 11: 70,394,726 V772D probably damaging Het
Pkdrej T A 15: 85,816,523 R1737S probably benign Het
Ppp1r13b A T 12: 111,834,886 Y578N probably damaging Het
Ppp1r3b A C 8: 35,384,175 K56T probably benign Het
Prdm11 G T 2: 92,989,283 H261N probably benign Het
Preb T A 5: 30,958,765 N166I probably benign Het
Psd3 T C 8: 67,882,982 K681R possibly damaging Het
Ptgs1 G A 2: 36,251,280 V580I probably damaging Het
Ptpro T A 6: 137,430,739 S949T probably benign Het
Pum2 A G 12: 8,748,802 E973G possibly damaging Het
Rdh1 A G 10: 127,760,023 D29G probably benign Het
Rel A G 11: 23,742,957 S359P probably benign Het
Rnf165 T C 18: 77,466,753 D248G possibly damaging Het
Ryr3 T A 2: 112,730,428 H2996L probably benign Het
Scarb1 C T 5: 125,294,039 C323Y probably damaging Het
Scn5a C T 9: 119,498,127 R1309H probably damaging Het
Serpinb12 T A 1: 106,953,739 V202E probably damaging Het
Shh A G 5: 28,458,300 L290P possibly damaging Het
Six4 CT C 12: 73,104,239 probably benign Het
Slc34a2 G A 5: 53,058,372 G42R probably benign Het
Slc41a1 A G 1: 131,830,823 N68D possibly damaging Het
Slc7a6os A G 8: 106,210,724 S64P probably damaging Het
Smc1b A G 15: 85,110,650 probably null Het
Snx9 T C 17: 5,918,476 V349A possibly damaging Het
Sstr1 G T 12: 58,213,527 G312V probably damaging Het
Tnfsf10 A G 3: 27,335,659 I290V probably benign Het
Trio A G 15: 27,805,684 C1717R possibly damaging Het
Ttbk1 T G 17: 46,446,568 S1047R probably damaging Het
Ttn T C 2: 76,916,533 D4724G probably benign Het
Uba1y T A Y: 825,542 N301K probably benign Het
Unc5c A G 3: 141,827,549 T853A probably benign Het
Vmn2r45 T A 7: 8,483,075 I405L probably benign Het
Wdr37 A T 13: 8,805,933 M458K probably damaging Het
Zdhhc14 A T 17: 5,712,454 Y211F probably benign Het
Zfp108 G A 7: 24,261,333 V450I probably benign Het
Zfp212 A T 6: 47,930,926 R280* probably null Het
Zfp940 A T 7: 29,835,617 V108E unknown Het
Other mutations in Eln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Eln APN 5 134719040 intron probably benign
IGL01941:Eln APN 5 134718170 intron probably benign
IGL02508:Eln APN 5 134704568 utr 3 prime probably benign
IGL02654:Eln APN 5 134717054 intron probably benign
PIT4696001:Eln UTSW 5 134737178 missense unknown
R0036:Eln UTSW 5 134711060 critical splice donor site probably null
R0594:Eln UTSW 5 134712398 splice site probably benign
R0849:Eln UTSW 5 134707981 nonsense probably null
R1434:Eln UTSW 5 134729437 splice site probably benign
R1481:Eln UTSW 5 134706572 missense probably damaging 0.99
R1682:Eln UTSW 5 134703782 makesense probably null
R1741:Eln UTSW 5 134729184 missense unknown
R1926:Eln UTSW 5 134706567 nonsense probably null
R1983:Eln UTSW 5 134736340 splice site probably null
R2033:Eln UTSW 5 134710106 critical splice donor site probably null
R2259:Eln UTSW 5 134729654 missense unknown
R2260:Eln UTSW 5 134729654 missense unknown
R4450:Eln UTSW 5 134725781 intron probably benign
R6502:Eln UTSW 5 134725774 intron probably benign
R7249:Eln UTSW 5 134711081 utr 3 prime probably benign
R7479:Eln UTSW 5 134707575 missense unknown
R7819:Eln UTSW 5 134737181 missense unknown
R7855:Eln UTSW 5 134711081 utr 3 prime probably benign
R7923:Eln UTSW 5 134711081 utr 3 prime probably benign
R8047:Eln UTSW 5 134729149 small deletion probably benign
R8048:Eln UTSW 5 134729149 small deletion probably benign
R8073:Eln UTSW 5 134729149 small deletion probably benign
R8141:Eln UTSW 5 134729149 small deletion probably benign
R8144:Eln UTSW 5 134729149 small deletion probably benign
R8344:Eln UTSW 5 134728392 missense unknown
R8413:Eln UTSW 5 134726521 missense unknown
R8554:Eln UTSW 5 134710110 utr 3 prime probably benign
R8857:Eln UTSW 5 134711081 utr 3 prime probably benign
Z1177:Eln UTSW 5 134718026 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCTGGGTAGAGATAGAGTCC -3'
(R):5'- AGTATTGAATCTGGTGTAAGCCGG -3'

Sequencing Primer
(F):5'- TCCTGGGAGGAGGTGAGTCC -3'
(R):5'- ATCTGGTGTAAGCCGGCAGATG -3'
Posted On2019-12-20