Incidental Mutation 'R7873:Ptpro'
ID 608244
Institutional Source Beutler Lab
Gene Symbol Ptpro
Ensembl Gene ENSMUSG00000030223
Gene Name protein tyrosine phosphatase receptor type O
Synonyms Ptpn15, PTP-BK, D28, PTPROt, PTP-phi, PTP-U2, GLEPP1, PTP-oc
MMRRC Submission 045925-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7873 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 137229317-137440231 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 137407737 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 949 (S949T)
Ref Sequence ENSEMBL: ENSMUSP00000076364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077115] [ENSMUST00000167002] [ENSMUST00000167679] [ENSMUST00000203914]
AlphaFold E9Q612
Predicted Effect probably benign
Transcript: ENSMUST00000077115
AA Change: S949T

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000076364
Gene: ENSMUSG00000030223
AA Change: S949T

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
PTPc 947 1207 1.43e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167002
AA Change: S128T

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131764
Gene: ENSMUSG00000030223
AA Change: S128T

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
PTPc 126 386 1.43e-127 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167679
AA Change: S921T

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127112
Gene: ENSMUSG00000030223
AA Change: S921T

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
PTPc 919 1179 1.43e-127 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000203914
AA Change: S100T

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144870
Gene: ENSMUSG00000030223
AA Change: S100T

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
PTPc 98 358 6.1e-130 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R3 subtype family of receptor-type protein tyrosine phosphatases. These proteins are localized to the apical surface of polarized cells and may have tissue-specific functions through activation of Src family kinases. This gene contains two distinct promoters, and alternatively spliced transcript variants encoding multiple isoforms have been observed. The encoded proteins may have multiple isoform-specific and tissue-specific functions, including the regulation of osteoclast production and activity, inhibition of cell proliferation and facilitation of apoptosis. This gene is a candidate tumor suppressor, and decreased expression of this gene has been observed in several types of cancer. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for one allele display impaired glomerular filtration due to podocyte structural anomalies and a predisposition for hypertension. Mice homozygous for a second allele exhibit susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,684,091 (GRCm39) I229F probably benign Het
Abca14 T C 7: 119,888,792 (GRCm39) L1246S probably benign Het
Abtb3 T C 10: 85,466,989 (GRCm39) V685A possibly damaging Het
Acacb A C 5: 114,361,339 (GRCm39) S1340R possibly damaging Het
Ankrd6 A T 4: 32,806,499 (GRCm39) S585T possibly damaging Het
Ark2c T C 18: 77,554,449 (GRCm39) D248G possibly damaging Het
Ccdc54 A G 16: 50,410,672 (GRCm39) V198A probably benign Het
Cnga4 A G 7: 105,056,249 (GRCm39) I387V probably damaging Het
Creg1 G T 1: 165,597,448 (GRCm39) D141Y probably damaging Het
Cxcr2 T C 1: 74,198,166 (GRCm39) L220P probably benign Het
Dennd5a T A 7: 109,526,141 (GRCm39) I344F probably damaging Het
Dysf A G 6: 84,060,747 (GRCm39) N448S probably benign Het
Efcab6 A G 15: 83,902,826 (GRCm39) probably null Het
Elf2 C A 3: 51,164,099 (GRCm39) V489F probably damaging Het
Elmod2 G T 8: 84,057,848 (GRCm39) H12N probably benign Het
Eln C T 5: 134,740,041 (GRCm39) G618E unknown Het
Fbxo33 G T 12: 59,265,807 (GRCm39) S153R possibly damaging Het
Fbxw7 A T 3: 84,833,071 (GRCm39) I38F possibly damaging Het
Flnc G A 6: 29,456,990 (GRCm39) V2329I possibly damaging Het
Fsip2 C T 2: 82,779,856 (GRCm39) R201C probably damaging Het
Gpr155 T C 2: 73,173,934 (GRCm39) E825G possibly damaging Het
Grk3 A T 5: 113,077,552 (GRCm39) M405K probably benign Het
H2bc7 A T 13: 23,758,244 (GRCm39) Y41N probably damaging Het
Hace1 T C 10: 45,548,883 (GRCm39) V597A possibly damaging Het
Ido1 A G 8: 25,074,758 (GRCm39) F295S probably damaging Het
Ighe T A 12: 113,234,942 (GRCm39) E406V Het
Ighv1-31 G T 12: 114,793,274 (GRCm39) A15E probably benign Het
Ighv1-75 A T 12: 115,797,988 (GRCm39) L10H probably damaging Het
Inpp5e T A 2: 26,297,957 (GRCm39) K215* probably null Het
Iqcn A G 8: 71,163,989 (GRCm39) M1061V probably benign Het
Krt18 C T 15: 101,939,391 (GRCm39) T288I probably benign Het
Lrwd1 A T 5: 136,152,792 (GRCm39) I490N probably benign Het
Macf1 T A 4: 123,398,344 (GRCm39) probably null Het
Mapk8ip3 A G 17: 25,125,146 (GRCm39) V482A probably benign Het
Mcidas G A 13: 113,135,521 (GRCm39) G315S probably damaging Het
Mdk A G 2: 91,761,773 (GRCm39) F7S probably benign Het
Mycbp2 G A 14: 103,393,582 (GRCm39) P2993L probably damaging Het
Niban3 A T 8: 72,054,892 (GRCm39) I193F probably damaging Het
Nme4 A T 17: 26,312,862 (GRCm39) Y99N probably damaging Het
Nr1d2 G A 14: 18,216,656 (GRCm38) R171* probably null Het
Or10h28 A G 17: 33,488,348 (GRCm39) I217V probably benign Het
Osgep G T 14: 51,153,347 (GRCm39) T326K probably damaging Het
Pdgfd C T 9: 6,337,271 (GRCm39) T201M probably benign Het
Pdk4 T C 6: 5,487,086 (GRCm39) D320G probably benign Het
Pelp1 A T 11: 70,285,552 (GRCm39) V772D probably damaging Het
Pkdrej T A 15: 85,700,724 (GRCm39) R1737S probably benign Het
Ppp1r13b A T 12: 111,801,320 (GRCm39) Y578N probably damaging Het
Ppp1r3b A C 8: 35,851,329 (GRCm39) K56T probably benign Het
Prdm11 G T 2: 92,819,628 (GRCm39) H261N probably benign Het
Preb T A 5: 31,116,109 (GRCm39) N166I probably benign Het
Psd3 T C 8: 68,335,634 (GRCm39) K681R possibly damaging Het
Ptgs1 G A 2: 36,141,292 (GRCm39) V580I probably damaging Het
Pum2 A G 12: 8,798,802 (GRCm39) E973G possibly damaging Het
Rdh1 A G 10: 127,595,892 (GRCm39) D29G probably benign Het
Rel A G 11: 23,692,957 (GRCm39) S359P probably benign Het
Ryr3 T A 2: 112,560,773 (GRCm39) H2996L probably benign Het
Scarb1 C T 5: 125,371,103 (GRCm39) C323Y probably damaging Het
Scn5a C T 9: 119,327,193 (GRCm39) R1309H probably damaging Het
Serpinb12 T A 1: 106,881,469 (GRCm39) V202E probably damaging Het
Shh A G 5: 28,663,298 (GRCm39) L290P possibly damaging Het
Six4 CT C 12: 73,151,013 (GRCm39) probably benign Het
Slc34a2 G A 5: 53,215,714 (GRCm39) G42R probably benign Het
Slc41a1 A G 1: 131,758,561 (GRCm39) N68D possibly damaging Het
Slc7a6os A G 8: 106,937,356 (GRCm39) S64P probably damaging Het
Slco1a7 T A 6: 141,673,448 (GRCm39) L363F probably benign Het
Smc1b A G 15: 84,994,851 (GRCm39) probably null Het
Snx9 T C 17: 5,968,751 (GRCm39) V349A possibly damaging Het
Sstr1 G T 12: 58,260,313 (GRCm39) G312V probably damaging Het
Tnfsf10 A G 3: 27,389,808 (GRCm39) I290V probably benign Het
Trio A G 15: 27,805,770 (GRCm39) C1717R possibly damaging Het
Ttbk1 T G 17: 46,757,494 (GRCm39) S1047R probably damaging Het
Ttn T C 2: 76,746,877 (GRCm39) D4724G probably benign Het
Uba1y T A Y: 825,542 (GRCm39) N301K probably benign Het
Unc5c A G 3: 141,533,310 (GRCm39) T853A probably benign Het
Vmn2r45 T A 7: 8,486,074 (GRCm39) I405L probably benign Het
Wdr37 A T 13: 8,855,969 (GRCm39) M458K probably damaging Het
Zdhhc14 A T 17: 5,762,729 (GRCm39) Y211F probably benign Het
Zfp108 G A 7: 23,960,758 (GRCm39) V450I probably benign Het
Zfp212 A T 6: 47,907,860 (GRCm39) R280* probably null Het
Zfp940 A T 7: 29,535,042 (GRCm39) V108E unknown Het
Other mutations in Ptpro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ptpro APN 6 137,371,907 (GRCm39) critical splice donor site probably null
IGL00844:Ptpro APN 6 137,391,237 (GRCm39) missense probably damaging 1.00
IGL00983:Ptpro APN 6 137,395,246 (GRCm39) missense probably benign 0.01
IGL01073:Ptpro APN 6 137,354,086 (GRCm39) missense probably damaging 1.00
IGL01832:Ptpro APN 6 137,370,666 (GRCm39) missense possibly damaging 0.93
IGL02308:Ptpro APN 6 137,431,698 (GRCm39) missense probably benign 0.37
IGL02387:Ptpro APN 6 137,387,978 (GRCm39) missense probably damaging 0.96
IGL02605:Ptpro APN 6 137,357,316 (GRCm39) missense probably benign 0.02
IGL02666:Ptpro APN 6 137,355,057 (GRCm39) missense probably damaging 0.96
IGL03275:Ptpro APN 6 137,427,004 (GRCm39) missense probably damaging 1.00
Brau UTSW 6 137,431,596 (GRCm39) missense probably damaging 1.00
court UTSW 6 137,370,673 (GRCm39) nonsense probably null
Hoff UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
Jester UTSW 6 137,426,915 (GRCm39) missense probably damaging 1.00
mann UTSW 6 137,388,114 (GRCm39) splice site probably null
R0017:Ptpro UTSW 6 137,393,825 (GRCm39) missense probably benign 0.03
R0017:Ptpro UTSW 6 137,393,825 (GRCm39) missense probably benign 0.03
R0020:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0022:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0023:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0024:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0094:Ptpro UTSW 6 137,363,350 (GRCm39) missense probably benign 0.08
R0094:Ptpro UTSW 6 137,363,350 (GRCm39) missense probably benign 0.08
R0103:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0106:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0316:Ptpro UTSW 6 137,353,987 (GRCm39) missense possibly damaging 0.81
R0427:Ptpro UTSW 6 137,345,294 (GRCm39) missense possibly damaging 0.81
R0456:Ptpro UTSW 6 137,391,228 (GRCm39) missense probably benign 0.04
R0536:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0537:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0552:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0555:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0664:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0708:Ptpro UTSW 6 137,363,251 (GRCm39) missense probably benign 0.26
R0730:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0735:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0738:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0786:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0811:Ptpro UTSW 6 137,345,077 (GRCm39) missense probably benign 0.00
R0812:Ptpro UTSW 6 137,345,077 (GRCm39) missense probably benign 0.00
R0881:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0973:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1145:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1145:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1146:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1146:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1147:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1147:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1259:Ptpro UTSW 6 137,369,739 (GRCm39) missense probably damaging 0.98
R1340:Ptpro UTSW 6 137,418,079 (GRCm39) missense possibly damaging 0.95
R1381:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1382:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1385:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1396:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1401:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1416:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1422:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1448:Ptpro UTSW 6 137,418,114 (GRCm39) missense probably damaging 1.00
R1513:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1518:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1526:Ptpro UTSW 6 137,438,724 (GRCm39) missense probably damaging 1.00
R1540:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1571:Ptpro UTSW 6 137,355,128 (GRCm39) missense probably benign
R1573:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1587:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1588:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1649:Ptpro UTSW 6 137,421,015 (GRCm39) nonsense probably null
R1700:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1701:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1745:Ptpro UTSW 6 137,377,643 (GRCm39) missense probably benign 0.03
R1772:Ptpro UTSW 6 137,407,741 (GRCm39) missense probably damaging 1.00
R1911:Ptpro UTSW 6 137,377,617 (GRCm39) splice site probably benign
R1958:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1967:Ptpro UTSW 6 137,393,863 (GRCm39) missense probably benign 0.38
R2025:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R2026:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R2040:Ptpro UTSW 6 137,363,162 (GRCm39) splice site probably benign
R2115:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R2117:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R2130:Ptpro UTSW 6 137,388,114 (GRCm39) splice site probably null
R2161:Ptpro UTSW 6 137,426,885 (GRCm39) missense probably benign 0.01
R2431:Ptpro UTSW 6 137,420,583 (GRCm39) nonsense probably null
R2915:Ptpro UTSW 6 137,391,239 (GRCm39) start gained probably benign
R2988:Ptpro UTSW 6 137,420,597 (GRCm39) nonsense probably null
R3772:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3773:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3795:Ptpro UTSW 6 137,357,307 (GRCm39) missense probably benign
R3885:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3886:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3887:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3888:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3893:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R4032:Ptpro UTSW 6 137,438,740 (GRCm39) missense probably damaging 1.00
R4133:Ptpro UTSW 6 137,397,370 (GRCm39) missense probably damaging 1.00
R4377:Ptpro UTSW 6 137,357,264 (GRCm39) missense probably benign 0.26
R4455:Ptpro UTSW 6 137,370,657 (GRCm39) missense probably damaging 1.00
R4613:Ptpro UTSW 6 137,393,834 (GRCm39) nonsense probably null
R4827:Ptpro UTSW 6 137,419,708 (GRCm39) missense probably damaging 1.00
R4863:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R4870:Ptpro UTSW 6 137,354,130 (GRCm39) missense probably damaging 0.96
R4910:Ptpro UTSW 6 137,345,336 (GRCm39) missense probably damaging 0.99
R4932:Ptpro UTSW 6 137,388,103 (GRCm39) nonsense probably null
R4941:Ptpro UTSW 6 137,369,763 (GRCm39) missense probably damaging 1.00
R4989:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R5009:Ptpro UTSW 6 137,354,130 (GRCm39) missense probably damaging 0.96
R5032:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R5033:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R5162:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R5393:Ptpro UTSW 6 137,357,222 (GRCm39) missense probably benign 0.04
R5423:Ptpro UTSW 6 137,419,705 (GRCm39) missense probably damaging 1.00
R5782:Ptpro UTSW 6 137,376,496 (GRCm39) missense possibly damaging 0.80
R6103:Ptpro UTSW 6 137,377,704 (GRCm39) missense possibly damaging 0.76
R6239:Ptpro UTSW 6 137,357,606 (GRCm39) missense probably benign 0.28
R6488:Ptpro UTSW 6 137,370,673 (GRCm39) nonsense probably null
R6494:Ptpro UTSW 6 137,359,640 (GRCm39) missense probably benign 0.20
R6746:Ptpro UTSW 6 137,371,821 (GRCm39) missense probably damaging 1.00
R6763:Ptpro UTSW 6 137,395,279 (GRCm39) splice site probably null
R6888:Ptpro UTSW 6 137,357,198 (GRCm39) missense probably benign 0.30
R6983:Ptpro UTSW 6 137,426,915 (GRCm39) missense probably damaging 1.00
R7019:Ptpro UTSW 6 137,357,476 (GRCm39) missense probably benign
R7218:Ptpro UTSW 6 137,431,596 (GRCm39) missense probably damaging 1.00
R7236:Ptpro UTSW 6 137,345,335 (GRCm39) missense probably damaging 1.00
R7299:Ptpro UTSW 6 137,418,142 (GRCm39) critical splice donor site probably null
R7381:Ptpro UTSW 6 137,376,559 (GRCm39) missense possibly damaging 0.93
R7493:Ptpro UTSW 6 137,359,647 (GRCm39) missense probably benign 0.01
R7733:Ptpro UTSW 6 137,391,284 (GRCm39) nonsense probably null
R7793:Ptpro UTSW 6 137,393,818 (GRCm39) missense probably damaging 0.99
R7804:Ptpro UTSW 6 137,376,599 (GRCm39) splice site probably null
R7833:Ptpro UTSW 6 137,393,861 (GRCm39) nonsense probably null
R7859:Ptpro UTSW 6 137,369,805 (GRCm39) critical splice donor site probably null
R8042:Ptpro UTSW 6 137,393,881 (GRCm39) missense possibly damaging 0.71
R8859:Ptpro UTSW 6 137,403,782 (GRCm39) nonsense probably null
R8979:Ptpro UTSW 6 137,345,140 (GRCm39) missense probably benign
R9138:Ptpro UTSW 6 137,388,113 (GRCm39) critical splice donor site probably null
R9309:Ptpro UTSW 6 137,431,656 (GRCm39) missense probably damaging 1.00
R9420:Ptpro UTSW 6 137,420,933 (GRCm39) missense probably benign 0.08
R9612:Ptpro UTSW 6 137,391,318 (GRCm39) missense probably benign 0.31
R9625:Ptpro UTSW 6 137,371,873 (GRCm39) missense probably damaging 1.00
R9697:Ptpro UTSW 6 137,363,288 (GRCm39) missense probably damaging 1.00
R9715:Ptpro UTSW 6 137,345,108 (GRCm39) missense probably damaging 0.96
Z1177:Ptpro UTSW 6 137,355,138 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGGTGTCATCCAATTACAC -3'
(R):5'- TAGCCTAGGAGTTCAGGTGG -3'

Sequencing Primer
(F):5'- CGGTGTCATCCAATTACACAGGTG -3'
(R):5'- AGTTCAGGTGGCTCTGACATC -3'
Posted On 2019-12-20