Incidental Mutation 'R0147:Drc1'
ID60825
Institutional Source Beutler Lab
Gene Symbol Drc1
Ensembl Gene ENSMUSG00000073102
Gene Namedynein regulatory complex subunit 1
SynonymsCcdc164, Gm1060, LOC381738, b2b1654Clo
MMRRC Submission 038431-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0147 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location30281388-30366695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30281489 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 13 (N13I)
Ref Sequence ENSEMBL: ENSMUSP00000098992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101448]
Predicted Effect possibly damaging
Transcript: ENSMUST00000101448
AA Change: N13I

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098992
Gene: ENSMUSG00000073102
AA Change: N13I

DomainStartEndE-ValueType
low complexity region 33 55 N/A INTRINSIC
low complexity region 62 79 N/A INTRINSIC
Pfam:NYD-SP28 100 200 1.7e-33 PFAM
coiled coil region 280 318 N/A INTRINSIC
low complexity region 455 473 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
low complexity region 599 612 N/A INTRINSIC
Pfam:NYD-SP28_assoc 673 732 2.2e-25 PFAM
Meta Mutation Damage Score 0.158 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 94.5%
  • 20x: 86.1%
Validation Efficiency 67% (88/131)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central component of the nexin-dynein complex (N-DRC), which regulates the assembly of ciliary dynein. Mutations in this gene can cause ciliary dyskinesia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit heterotaxy with complex congenital heart disease such as transposition of the great arteries (TGA), atrioventricular septal defects (AVSD), and vein abnormalities; immotile/dyskinetic airway cilia are also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,189,271 R594C probably damaging Het
A2m T C 6: 121,662,446 probably null Het
Abtb2 A G 2: 103,567,135 I137V probably benign Het
Ank1 T A 8: 23,123,977 N1545K probably damaging Het
Arl6 T C 16: 59,618,790 probably benign Het
Avl9 T A 6: 56,736,502 D248E probably benign Het
Becn1 T C 11: 101,301,736 E40G probably damaging Het
Bod1l G T 5: 41,818,697 A1758E possibly damaging Het
Btbd16 C T 7: 130,779,594 T19I probably damaging Het
Casc3 T A 11: 98,822,499 N246K possibly damaging Het
Celf1 G T 2: 91,004,690 probably benign Het
Chrm3 G T 13: 9,878,744 N85K probably damaging Het
Cluh T A 11: 74,665,938 Y935N probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col6a5 T C 9: 105,925,794 D1324G unknown Het
Ctcfl T C 2: 173,118,547 D81G possibly damaging Het
D630003M21Rik C T 2: 158,203,067 probably benign Het
Ddx39 C T 8: 83,722,476 R298C possibly damaging Het
Dnmt3b T G 2: 153,661,457 N9K possibly damaging Het
Dock8 T C 19: 25,119,459 L577P probably benign Het
Eml4 T A 17: 83,421,652 N85K probably damaging Het
Epb41l4a T C 18: 33,798,800 T581A probably damaging Het
Epha3 T C 16: 63,612,944 D446G possibly damaging Het
Fam208a A G 14: 27,471,768 D975G probably benign Het
Fam209 G T 2: 172,473,980 G92C probably damaging Het
Fam98c T A 7: 29,152,721 R340* probably null Het
Fbxw10 T G 11: 62,847,481 probably null Het
Galr1 A G 18: 82,405,570 L194P probably benign Het
Gar1 T C 3: 129,829,473 H89R probably damaging Het
Gbp4 T A 5: 105,119,496 Y519F probably benign Het
Gm28042 T A 2: 120,036,463 S196T probably benign Het
Grid2 T C 6: 64,533,587 Y734H probably benign Het
Grm6 T A 11: 50,859,317 I466N possibly damaging Het
Hectd3 T C 4: 116,997,040 probably benign Het
Hpse2 A C 19: 42,931,660 probably null Het
Hspb7 T C 4: 141,423,991 I148T probably damaging Het
Htr1d C A 4: 136,443,477 T339K probably damaging Het
Ip6k1 T A 9: 108,045,894 D408E probably damaging Het
Irs2 A T 8: 11,007,568 M288K probably damaging Het
Kansl3 A T 1: 36,353,816 C225S probably damaging Het
Knop1 C A 7: 118,845,838 R301L probably benign Het
Lama5 T C 2: 180,190,406 H1714R probably benign Het
Mettl14 G A 3: 123,371,394 T316I probably damaging Het
Mmp15 A T 8: 95,372,317 N591Y probably benign Het
Mprip T A 11: 59,737,073 D93E possibly damaging Het
Mtmr14 T A 6: 113,260,666 probably benign Het
Muc5ac T C 7: 141,811,039 S1917P probably benign Het
Muc6 C T 7: 141,651,990 C75Y probably damaging Het
Naip1 A T 13: 100,426,910 H582Q possibly damaging Het
Nbeal2 G A 9: 110,642,143 R264* probably null Het
Neb T C 2: 52,249,376 K140E probably damaging Het
Nfya A G 17: 48,398,998 V48A possibly damaging Het
Ngf G T 3: 102,509,803 probably benign Het
Nsmce2 T G 15: 59,378,957 S26A probably damaging Het
Olfr1026 T A 2: 85,924,018 I250N possibly damaging Het
Olfr601 T C 7: 103,358,406 T263A possibly damaging Het
Olfr873 T G 9: 20,301,091 M297R probably damaging Het
Pax1 A G 2: 147,373,734 S424G probably benign Het
Pcdhb19 A T 18: 37,497,182 Q10L probably benign Het
Pdcl T C 2: 37,352,130 I203V probably benign Het
Pknox1 T A 17: 31,604,790 N379K probably benign Het
Plxna1 C T 6: 89,320,710 A1831T possibly damaging Het
Prodh T G 16: 18,077,813 Q360P probably damaging Het
Pygo2 T C 3: 89,433,303 V299A probably damaging Het
Raf1 C T 6: 115,632,973 G202S probably benign Het
Rgs11 T A 17: 26,207,459 probably null Het
Rnf13 A G 3: 57,802,468 D144G probably damaging Het
Rtel1 T C 2: 181,321,046 C31R probably damaging Het
Rubcnl T A 14: 75,042,458 I427K probably damaging Het
Sec23ip C T 7: 128,779,051 probably benign Het
Slc25a26 T A 6: 94,592,526 probably null Het
Slc6a7 A G 18: 61,002,111 probably benign Het
Slco6b1 A T 1: 96,987,837 noncoding transcript Het
Spata17 A G 1: 187,112,601 V111A probably damaging Het
Spata22 T A 11: 73,331,153 M1K probably null Het
Svep1 C T 4: 58,116,608 D881N possibly damaging Het
Sypl2 T A 3: 108,219,095 N67I possibly damaging Het
Tenm3 T C 8: 48,236,720 Y1944C probably damaging Het
Tm9sf4 G T 2: 153,195,313 V365L probably benign Het
Tmc3 T C 7: 83,607,742 V401A probably damaging Het
Trpm2 C T 10: 77,925,825 G997D probably damaging Het
Unc5b A T 10: 60,772,297 S675T probably damaging Het
Vmn1r217 A G 13: 23,113,937 M265T probably benign Het
Vps54 T A 11: 21,300,259 D548E probably benign Het
Wdfy3 A G 5: 101,917,411 V1297A probably benign Het
Wdr46 T A 17: 33,941,023 F70I probably benign Het
Zdbf2 C T 1: 63,304,006 Q515* probably null Het
Zfp710 T A 7: 80,081,973 C299* probably null Het
Other mutations in Drc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Drc1 APN 5 30345663 missense probably damaging 1.00
IGL02123:Drc1 APN 5 30347104 missense probably benign 0.07
IGL02839:Drc1 APN 5 30350423 missense probably benign 0.02
putative UTSW 5 30356288 missense probably benign 0.11
PIT4431001:Drc1 UTSW 5 30347073 missense probably damaging 0.98
R0148:Drc1 UTSW 5 30281489 missense possibly damaging 0.90
R0590:Drc1 UTSW 5 30363136 missense probably benign 0.00
R1640:Drc1 UTSW 5 30363957 missense possibly damaging 0.81
R1799:Drc1 UTSW 5 30366497 missense probably damaging 1.00
R2105:Drc1 UTSW 5 30356441 missense probably benign 0.01
R2252:Drc1 UTSW 5 30342731 missense probably benign 0.00
R2366:Drc1 UTSW 5 30366550 makesense probably null
R2570:Drc1 UTSW 5 30355265 missense probably damaging 1.00
R4036:Drc1 UTSW 5 30347182 missense probably benign
R4181:Drc1 UTSW 5 30355713 missense probably benign 0.16
R4210:Drc1 UTSW 5 30347146 missense possibly damaging 0.47
R4329:Drc1 UTSW 5 30355658 missense probably benign 0.16
R4560:Drc1 UTSW 5 30363097 missense probably benign
R4765:Drc1 UTSW 5 30348731 missense probably benign 0.04
R5239:Drc1 UTSW 5 30363123 missense probably benign 0.00
R5375:Drc1 UTSW 5 30356401 missense probably benign
R5838:Drc1 UTSW 5 30366513 unclassified probably null
R5933:Drc1 UTSW 5 30345529 missense probably damaging 0.99
R6014:Drc1 UTSW 5 30345649 missense probably damaging 1.00
R6408:Drc1 UTSW 5 30356288 missense probably benign 0.11
R6710:Drc1 UTSW 5 30363085 missense possibly damaging 0.83
R6755:Drc1 UTSW 5 30355146 missense probably damaging 1.00
R7341:Drc1 UTSW 5 30364468 missense probably damaging 1.00
X0018:Drc1 UTSW 5 30345544 missense probably damaging 1.00
X0021:Drc1 UTSW 5 30356423 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TCAGGCAAGGGGAATCAAGTCCAC -3'
(R):5'- CGCGGTCCATTACATCTCGTCAAC -3'

Sequencing Primer
(F):5'- AACTCGTAGTGCCTGACAG -3'
(R):5'- cacacacacacacacacacac -3'
Posted On2013-07-24