Incidental Mutation 'R7873:Pkdrej'
ID608283
Institutional Source Beutler Lab
Gene Symbol Pkdrej
Ensembl Gene ENSMUSG00000052496
Gene Namepolycystin (PKD) family receptor for egg jelly
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R7873 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location85814670-85821734 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85816523 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 1737 (R1737S)
Ref Sequence ENSEMBL: ENSMUSP00000086352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064370] [ENSMUST00000071876] [ENSMUST00000134631] [ENSMUST00000144067] [ENSMUST00000150995] [ENSMUST00000154814]
Predicted Effect probably benign
Transcript: ENSMUST00000064370
AA Change: R1737S

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000086352
Gene: ENSMUSG00000052496
AA Change: R1737S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:REJ 130 598 6.2e-116 PFAM
coiled coil region 657 687 N/A INTRINSIC
low complexity region 942 947 N/A INTRINSIC
GPS 984 1050 1.37e-2 SMART
transmembrane domain 1067 1089 N/A INTRINSIC
LH2 1114 1230 3.35e-6 SMART
transmembrane domain 1274 1292 N/A INTRINSIC
transmembrane domain 1312 1334 N/A INTRINSIC
low complexity region 1407 1415 N/A INTRINSIC
transmembrane domain 1451 1473 N/A INTRINSIC
transmembrane domain 1483 1505 N/A INTRINSIC
low complexity region 1571 1579 N/A INTRINSIC
transmembrane domain 1581 1603 N/A INTRINSIC
Pfam:PKD_channel 1621 2051 5.2e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071876
SMART Domains Protein: ENSMUSP00000071772
Gene: ENSMUSG00000064284

DomainStartEndE-ValueType
Pfam:C6_DPF 13 106 3.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134631
SMART Domains Protein: ENSMUSP00000121889
Gene: ENSMUSG00000064284

DomainStartEndE-ValueType
Pfam:C6_DPF 13 109 1.6e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144067
SMART Domains Protein: ENSMUSP00000119728
Gene: ENSMUSG00000064284

DomainStartEndE-ValueType
Pfam:C6_DPF 13 109 1.6e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150995
SMART Domains Protein: ENSMUSP00000123174
Gene: ENSMUSG00000064284

DomainStartEndE-ValueType
Pfam:C6_DPF 13 109 1.6e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154814
SMART Domains Protein: ENSMUSP00000116823
Gene: ENSMUSG00000064284

DomainStartEndE-ValueType
Pfam:C6_DPF 13 78 1e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a receptor for egg jelly (REJ) domain, a G-protein-coupled receptor proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may play a role in human reproduction. Alternative splice variants have been described but their biological natures have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null males are fertile in unrestricted mating trials but show lower reproductive success in sequential mating and artificial insemination trials. Although mutant sperm are able to capacitate in vitro, they acquire exocytotic competence at a slower rate than wild-type sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,866,227 I229F probably benign Het
Abca14 T C 7: 120,289,569 L1246S probably benign Het
Acacb A C 5: 114,223,278 S1340R possibly damaging Het
Ankrd6 A T 4: 32,806,499 S585T possibly damaging Het
Btbd11 T C 10: 85,631,125 V685A possibly damaging Het
Ccdc54 A G 16: 50,590,309 V198A probably benign Het
Cnga4 A G 7: 105,407,042 I387V probably damaging Het
Creg1 G T 1: 165,769,879 D141Y probably damaging Het
Cxcr2 T C 1: 74,159,007 L220P probably benign Het
Dennd5a T A 7: 109,926,934 I344F probably damaging Het
Dysf A G 6: 84,083,765 N448S probably benign Het
Efcab6 A G 15: 84,018,625 probably null Het
Elf2 C A 3: 51,256,678 V489F probably damaging Het
Elmod2 G T 8: 83,331,219 H12N probably benign Het
Eln C T 5: 134,711,187 G618E unknown Het
Fam129c A T 8: 71,602,248 I193F probably damaging Het
Fbxo33 G T 12: 59,219,021 S153R possibly damaging Het
Fbxw7 A T 3: 84,925,764 I38F possibly damaging Het
Flnc G A 6: 29,456,991 V2329I possibly damaging Het
Fsip2 C T 2: 82,949,512 R201C probably damaging Het
Gm16486 A G 8: 70,711,340 M1061V probably benign Het
Gm5724 T A 6: 141,727,722 L363F probably benign Het
Gpr155 T C 2: 73,343,590 E825G possibly damaging Het
Grk3 A T 5: 112,929,686 M405K probably benign Het
Hace1 T C 10: 45,672,787 V597A possibly damaging Het
Hist1h2bf A T 13: 23,574,070 Y41N probably damaging Het
Ido1 A G 8: 24,584,742 F295S probably damaging Het
Ighe T A 12: 113,271,322 E406V Het
Ighv1-31 G T 12: 114,829,654 A15E probably benign Het
Ighv1-75 A T 12: 115,834,368 L10H probably damaging Het
Inpp5e T A 2: 26,407,945 K215* probably null Het
Krt18 C T 15: 102,030,956 T288I probably benign Het
Lrwd1 A T 5: 136,123,938 I490N probably benign Het
Macf1 T A 4: 123,504,551 probably null Het
Mapk8ip3 A G 17: 24,906,172 V482A probably benign Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Mdk A G 2: 91,931,428 F7S probably benign Het
Mycbp2 G A 14: 103,156,146 P2993L probably damaging Het
Nme4 A T 17: 26,093,888 Y99N probably damaging Het
Nr1d2 G A 14: 18,216,656 R171* probably null Het
Olfr63 A G 17: 33,269,374 I217V probably benign Het
Osgep G T 14: 50,915,890 T326K probably damaging Het
Pdgfd C T 9: 6,337,271 T201M probably benign Het
Pdk4 T C 6: 5,487,086 D320G probably benign Het
Pelp1 A T 11: 70,394,726 V772D probably damaging Het
Ppp1r13b A T 12: 111,834,886 Y578N probably damaging Het
Ppp1r3b A C 8: 35,384,175 K56T probably benign Het
Prdm11 G T 2: 92,989,283 H261N probably benign Het
Preb T A 5: 30,958,765 N166I probably benign Het
Psd3 T C 8: 67,882,982 K681R possibly damaging Het
Ptgs1 G A 2: 36,251,280 V580I probably damaging Het
Ptpro T A 6: 137,430,739 S949T probably benign Het
Pum2 A G 12: 8,748,802 E973G possibly damaging Het
Rdh1 A G 10: 127,760,023 D29G probably benign Het
Rel A G 11: 23,742,957 S359P probably benign Het
Rnf165 T C 18: 77,466,753 D248G possibly damaging Het
Ryr3 T A 2: 112,730,428 H2996L probably benign Het
Scarb1 C T 5: 125,294,039 C323Y probably damaging Het
Scn5a C T 9: 119,498,127 R1309H probably damaging Het
Serpinb12 T A 1: 106,953,739 V202E probably damaging Het
Shh A G 5: 28,458,300 L290P possibly damaging Het
Six4 CT C 12: 73,104,239 probably benign Het
Slc34a2 G A 5: 53,058,372 G42R probably benign Het
Slc41a1 A G 1: 131,830,823 N68D possibly damaging Het
Slc7a6os A G 8: 106,210,724 S64P probably damaging Het
Smc1b A G 15: 85,110,650 probably null Het
Snx9 T C 17: 5,918,476 V349A possibly damaging Het
Sstr1 G T 12: 58,213,527 G312V probably damaging Het
Tnfsf10 A G 3: 27,335,659 I290V probably benign Het
Trio A G 15: 27,805,684 C1717R possibly damaging Het
Ttbk1 T G 17: 46,446,568 S1047R probably damaging Het
Ttn T C 2: 76,916,533 D4724G probably benign Het
Uba1y T A Y: 825,542 N301K probably benign Het
Unc5c A G 3: 141,827,549 T853A probably benign Het
Vmn2r45 T A 7: 8,483,075 I405L probably benign Het
Wdr37 A T 13: 8,805,933 M458K probably damaging Het
Zdhhc14 A T 17: 5,712,454 Y211F probably benign Het
Zfp108 G A 7: 24,261,333 V450I probably benign Het
Zfp212 A T 6: 47,930,926 R280* probably null Het
Zfp940 A T 7: 29,835,617 V108E unknown Het
Other mutations in Pkdrej
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Pkdrej APN 15 85817226 missense probably damaging 1.00
IGL00981:Pkdrej APN 15 85819656 missense probably damaging 1.00
IGL01066:Pkdrej APN 15 85816159 missense probably benign 0.22
IGL01461:Pkdrej APN 15 85820374 missense possibly damaging 0.77
IGL01514:Pkdrej APN 15 85818063 missense possibly damaging 0.82
IGL01606:Pkdrej APN 15 85817700 missense possibly damaging 0.67
IGL01836:Pkdrej APN 15 85820958 missense probably damaging 1.00
IGL02089:Pkdrej APN 15 85816288 missense possibly damaging 0.87
IGL02197:Pkdrej APN 15 85815793 missense possibly damaging 0.89
IGL02331:Pkdrej APN 15 85821327 missense probably damaging 1.00
IGL02559:Pkdrej APN 15 85817848 missense probably benign
IGL02708:Pkdrej APN 15 85820787 missense probably damaging 1.00
IGL02739:Pkdrej APN 15 85819694 missense probably benign 0.41
IGL02741:Pkdrej APN 15 85817430 missense probably benign 0.04
IGL02882:Pkdrej APN 15 85817296 missense probably damaging 1.00
IGL02968:Pkdrej APN 15 85816181 nonsense probably null
IGL03250:Pkdrej APN 15 85821355 missense possibly damaging 0.92
FR4548:Pkdrej UTSW 15 85819680 small insertion probably benign
FR4737:Pkdrej UTSW 15 85819680 small insertion probably benign
PIT1430001:Pkdrej UTSW 15 85821292 missense probably damaging 0.99
PIT4280001:Pkdrej UTSW 15 85819935 missense probably benign 0.01
R0004:Pkdrej UTSW 15 85818183 missense probably damaging 1.00
R0116:Pkdrej UTSW 15 85817545 nonsense probably null
R0117:Pkdrej UTSW 15 85816099 unclassified probably null
R0137:Pkdrej UTSW 15 85821567 missense possibly damaging 0.95
R0141:Pkdrej UTSW 15 85815630 missense probably damaging 0.99
R0325:Pkdrej UTSW 15 85819551 missense probably benign 0.08
R0714:Pkdrej UTSW 15 85815511 missense possibly damaging 0.85
R0749:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R0750:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R0755:Pkdrej UTSW 15 85816135 missense probably benign 0.00
R0938:Pkdrej UTSW 15 85818163 missense probably damaging 1.00
R1126:Pkdrej UTSW 15 85816314 missense probably damaging 0.99
R1204:Pkdrej UTSW 15 85818312 missense probably damaging 1.00
R1353:Pkdrej UTSW 15 85818918 missense probably damaging 1.00
R1471:Pkdrej UTSW 15 85817133 missense probably benign 0.37
R1510:Pkdrej UTSW 15 85816762 missense possibly damaging 0.61
R1573:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R1588:Pkdrej UTSW 15 85817241 missense probably benign 0.44
R1739:Pkdrej UTSW 15 85820427 missense probably benign 0.03
R1779:Pkdrej UTSW 15 85821171 missense possibly damaging 0.83
R1781:Pkdrej UTSW 15 85821171 missense possibly damaging 0.83
R1828:Pkdrej UTSW 15 85819282 missense possibly damaging 0.48
R1865:Pkdrej UTSW 15 85820324 nonsense probably null
R1870:Pkdrej UTSW 15 85816431 missense probably damaging 1.00
R1937:Pkdrej UTSW 15 85819167 missense probably benign 0.00
R2069:Pkdrej UTSW 15 85821231 missense probably benign 0.01
R2113:Pkdrej UTSW 15 85818984 missense probably damaging 1.00
R2135:Pkdrej UTSW 15 85816506 missense probably damaging 1.00
R2428:Pkdrej UTSW 15 85817572 nonsense probably null
R2991:Pkdrej UTSW 15 85819936 missense probably benign 0.00
R3029:Pkdrej UTSW 15 85817004 missense probably benign 0.16
R3162:Pkdrej UTSW 15 85816617 missense probably damaging 1.00
R3162:Pkdrej UTSW 15 85816617 missense probably damaging 1.00
R3747:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R3748:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R3749:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R4028:Pkdrej UTSW 15 85817492 missense probably benign 0.02
R4169:Pkdrej UTSW 15 85816314 missense probably benign 0.24
R4241:Pkdrej UTSW 15 85818144 missense probably damaging 1.00
R4242:Pkdrej UTSW 15 85818144 missense probably damaging 1.00
R4705:Pkdrej UTSW 15 85821167 nonsense probably null
R4939:Pkdrej UTSW 15 85820283 missense possibly damaging 0.82
R4954:Pkdrej UTSW 15 85816401 missense probably damaging 0.99
R4974:Pkdrej UTSW 15 85820409 missense probably benign 0.00
R4982:Pkdrej UTSW 15 85818996 missense probably damaging 0.99
R5105:Pkdrej UTSW 15 85816384 missense probably damaging 1.00
R5270:Pkdrej UTSW 15 85818327 missense probably damaging 1.00
R5296:Pkdrej UTSW 15 85817118 missense possibly damaging 0.67
R5631:Pkdrej UTSW 15 85820437 missense probably benign
R5909:Pkdrej UTSW 15 85818296 missense possibly damaging 0.82
R5998:Pkdrej UTSW 15 85815453 missense probably benign 0.01
R6037:Pkdrej UTSW 15 85819766 missense probably damaging 0.99
R6037:Pkdrej UTSW 15 85819766 missense probably damaging 0.99
R6125:Pkdrej UTSW 15 85816384 missense probably damaging 1.00
R6270:Pkdrej UTSW 15 85821105 nonsense probably null
R6500:Pkdrej UTSW 15 85819546 missense probably damaging 0.98
R6776:Pkdrej UTSW 15 85817309 nonsense probably null
R6786:Pkdrej UTSW 15 85818649 missense probably benign
R6866:Pkdrej UTSW 15 85820881 missense probably damaging 1.00
R6954:Pkdrej UTSW 15 85817853 nonsense probably null
R7086:Pkdrej UTSW 15 85820116 missense probably damaging 1.00
R7231:Pkdrej UTSW 15 85816188 missense possibly damaging 0.55
R7233:Pkdrej UTSW 15 85821148 missense probably damaging 0.96
R7289:Pkdrej UTSW 15 85821100 missense probably benign
R7549:Pkdrej UTSW 15 85819793 missense probably damaging 1.00
R7582:Pkdrej UTSW 15 85818921 missense possibly damaging 0.92
R7677:Pkdrej UTSW 15 85815587 missense probably benign 0.01
R7791:Pkdrej UTSW 15 85815931 missense possibly damaging 0.87
R7956:Pkdrej UTSW 15 85816523 missense probably benign 0.29
Z1177:Pkdrej UTSW 15 85816537 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAGACTTCGAATACAACCGAAATG -3'
(R):5'- CGTGTCTGTTGGCCAAGAAG -3'

Sequencing Primer
(F):5'- TGCTACACATCAGACTGGTG -3'
(R):5'- CTGTTGGCCAAGAAGTTTGTACAGAG -3'
Posted On2019-12-20