Incidental Mutation 'R7873:Snx9'
ID 608288
Institutional Source Beutler Lab
Gene Symbol Snx9
Ensembl Gene ENSMUSG00000002365
Gene Name sorting nexin 9
Synonyms SH3PX1, SDP1
MMRRC Submission 045925-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.924) question?
Stock # R7873 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 5841329-5931954 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 5918476 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 349 (V349A)
Ref Sequence ENSEMBL: ENSMUSP00000002436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002436]
AlphaFold Q91VH2
PDB Structure Solution structure of the SH3 domain from mouse sorting nexin-9 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002436
AA Change: V349A

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000002436
Gene: ENSMUSG00000002365
AA Change: V349A

DomainStartEndE-ValueType
SH3 3 61 1.51e-16 SMART
low complexity region 84 100 N/A INTRINSIC
low complexity region 160 170 N/A INTRINSIC
PX 247 357 4.15e-23 SMART
Pfam:BAR_3_WASP_bdg 358 593 2.4e-120 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phosphoinositide binding domain, and are involved in intracellular trafficking. The encoded protein does not contain a coiled coil region, like some family members, but does contain a SRC homology domain near its N-terminus. The encoded protein is reported to have a variety of interaction partners, including of adaptor protein 2 , dynamin, tyrosine kinase non-receptor 2, Wiskott-Aldrich syndrome-like, and ARP3 actin-related protein 3. The encoded protein is implicated in several stages of intracellular trafficking, including endocytosis, macropinocytosis, and F-actin nucleation. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,866,227 I229F probably benign Het
Abca14 T C 7: 120,289,569 L1246S probably benign Het
Acacb A C 5: 114,223,278 S1340R possibly damaging Het
Ankrd6 A T 4: 32,806,499 S585T possibly damaging Het
Btbd11 T C 10: 85,631,125 V685A possibly damaging Het
Ccdc54 A G 16: 50,590,309 V198A probably benign Het
Cnga4 A G 7: 105,407,042 I387V probably damaging Het
Creg1 G T 1: 165,769,879 D141Y probably damaging Het
Cxcr2 T C 1: 74,159,007 L220P probably benign Het
Dennd5a T A 7: 109,926,934 I344F probably damaging Het
Dysf A G 6: 84,083,765 N448S probably benign Het
Efcab6 A G 15: 84,018,625 probably null Het
Elf2 C A 3: 51,256,678 V489F probably damaging Het
Elmod2 G T 8: 83,331,219 H12N probably benign Het
Eln C T 5: 134,711,187 G618E unknown Het
Fam129c A T 8: 71,602,248 I193F probably damaging Het
Fbxo33 G T 12: 59,219,021 S153R possibly damaging Het
Fbxw7 A T 3: 84,925,764 I38F possibly damaging Het
Flnc G A 6: 29,456,991 V2329I possibly damaging Het
Fsip2 C T 2: 82,949,512 R201C probably damaging Het
Gm16486 A G 8: 70,711,340 M1061V probably benign Het
Gm5724 T A 6: 141,727,722 L363F probably benign Het
Gpr155 T C 2: 73,343,590 E825G possibly damaging Het
Grk3 A T 5: 112,929,686 M405K probably benign Het
Hace1 T C 10: 45,672,787 V597A possibly damaging Het
Hist1h2bf A T 13: 23,574,070 Y41N probably damaging Het
Ido1 A G 8: 24,584,742 F295S probably damaging Het
Ighe T A 12: 113,271,322 E406V Het
Ighv1-31 G T 12: 114,829,654 A15E probably benign Het
Ighv1-75 A T 12: 115,834,368 L10H probably damaging Het
Inpp5e T A 2: 26,407,945 K215* probably null Het
Krt18 C T 15: 102,030,956 T288I probably benign Het
Lrwd1 A T 5: 136,123,938 I490N probably benign Het
Macf1 T A 4: 123,504,551 probably null Het
Mapk8ip3 A G 17: 24,906,172 V482A probably benign Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Mdk A G 2: 91,931,428 F7S probably benign Het
Mycbp2 G A 14: 103,156,146 P2993L probably damaging Het
Nme4 A T 17: 26,093,888 Y99N probably damaging Het
Nr1d2 G A 14: 18,216,656 R171* probably null Het
Olfr63 A G 17: 33,269,374 I217V probably benign Het
Osgep G T 14: 50,915,890 T326K probably damaging Het
Pdgfd C T 9: 6,337,271 T201M probably benign Het
Pdk4 T C 6: 5,487,086 D320G probably benign Het
Pelp1 A T 11: 70,394,726 V772D probably damaging Het
Pkdrej T A 15: 85,816,523 R1737S probably benign Het
Ppp1r13b A T 12: 111,834,886 Y578N probably damaging Het
Ppp1r3b A C 8: 35,384,175 K56T probably benign Het
Prdm11 G T 2: 92,989,283 H261N probably benign Het
Preb T A 5: 30,958,765 N166I probably benign Het
Psd3 T C 8: 67,882,982 K681R possibly damaging Het
Ptgs1 G A 2: 36,251,280 V580I probably damaging Het
Ptpro T A 6: 137,430,739 S949T probably benign Het
Pum2 A G 12: 8,748,802 E973G possibly damaging Het
Rdh1 A G 10: 127,760,023 D29G probably benign Het
Rel A G 11: 23,742,957 S359P probably benign Het
Rnf165 T C 18: 77,466,753 D248G possibly damaging Het
Ryr3 T A 2: 112,730,428 H2996L probably benign Het
Scarb1 C T 5: 125,294,039 C323Y probably damaging Het
Scn5a C T 9: 119,498,127 R1309H probably damaging Het
Serpinb12 T A 1: 106,953,739 V202E probably damaging Het
Shh A G 5: 28,458,300 L290P possibly damaging Het
Six4 CT C 12: 73,104,239 probably benign Het
Slc34a2 G A 5: 53,058,372 G42R probably benign Het
Slc41a1 A G 1: 131,830,823 N68D possibly damaging Het
Slc7a6os A G 8: 106,210,724 S64P probably damaging Het
Smc1b A G 15: 85,110,650 probably null Het
Sstr1 G T 12: 58,213,527 G312V probably damaging Het
Tnfsf10 A G 3: 27,335,659 I290V probably benign Het
Trio A G 15: 27,805,684 C1717R possibly damaging Het
Ttbk1 T G 17: 46,446,568 S1047R probably damaging Het
Ttn T C 2: 76,916,533 D4724G probably benign Het
Uba1y T A Y: 825,542 N301K probably benign Het
Unc5c A G 3: 141,827,549 T853A probably benign Het
Vmn2r45 T A 7: 8,483,075 I405L probably benign Het
Wdr37 A T 13: 8,805,933 M458K probably damaging Het
Zdhhc14 A T 17: 5,712,454 Y211F probably benign Het
Zfp108 G A 7: 24,261,333 V450I probably benign Het
Zfp212 A T 6: 47,930,926 R280* probably null Het
Zfp940 A T 7: 29,835,617 V108E unknown Het
Other mutations in Snx9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Snx9 APN 17 5899361 missense probably benign
IGL00417:Snx9 APN 17 5891897 missense probably benign 0.03
IGL01827:Snx9 APN 17 5887012 missense probably benign 0.04
IGL02531:Snx9 APN 17 5891820 missense probably benign
IGL02710:Snx9 APN 17 5908598 missense probably damaging 1.00
IGL03088:Snx9 APN 17 5924610 missense probably benign
san_angelo UTSW 17 5891809 nonsense probably null
PIT4495001:Snx9 UTSW 17 5920126 missense possibly damaging 0.54
R0555:Snx9 UTSW 17 5918413 missense probably damaging 0.97
R1015:Snx9 UTSW 17 5920127 missense probably benign 0.12
R1065:Snx9 UTSW 17 5902361 splice site probably benign
R1421:Snx9 UTSW 17 5902484 missense probably benign 0.45
R1657:Snx9 UTSW 17 5918436 missense possibly damaging 0.65
R1823:Snx9 UTSW 17 5920671 missense probably damaging 1.00
R1914:Snx9 UTSW 17 5928256 missense possibly damaging 0.65
R3703:Snx9 UTSW 17 5928200 splice site probably null
R3871:Snx9 UTSW 17 5891781 missense probably benign 0.00
R4375:Snx9 UTSW 17 5908626 nonsense probably null
R4412:Snx9 UTSW 17 5908394 missense probably damaging 0.96
R4669:Snx9 UTSW 17 5927224 missense probably damaging 1.00
R4974:Snx9 UTSW 17 5902519 splice site probably null
R5038:Snx9 UTSW 17 5887073 missense probably benign 0.12
R5137:Snx9 UTSW 17 5928253 missense probably damaging 1.00
R5369:Snx9 UTSW 17 5920580 missense probably damaging 1.00
R5459:Snx9 UTSW 17 5920638 missense probably damaging 0.99
R5624:Snx9 UTSW 17 5891809 nonsense probably null
R5847:Snx9 UTSW 17 5924621 missense possibly damaging 0.94
R5953:Snx9 UTSW 17 5908402 missense probably damaging 1.00
R5953:Snx9 UTSW 17 5908403 missense probably damaging 1.00
R6263:Snx9 UTSW 17 5887049 missense probably damaging 0.98
R6481:Snx9 UTSW 17 5922209 critical splice donor site probably null
R6491:Snx9 UTSW 17 5920162 missense probably benign 0.00
R8471:Snx9 UTSW 17 5890090 missense probably damaging 1.00
R9451:Snx9 UTSW 17 5899493 missense probably damaging 0.99
R9748:Snx9 UTSW 17 5899395 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGAGCCTTTACAGAAAGCCTTTC -3'
(R):5'- ATACAGAAGCCTGCTGGTTGG -3'

Sequencing Primer
(F):5'- TCTGCCAAGTATCCAGTACTCATAGG -3'
(R):5'- GGTTGGCAGCTCTTCTCACTG -3'
Posted On 2019-12-20