Incidental Mutation 'R7874:Cerkl'
ID608297
Institutional Source Beutler Lab
Gene Symbol Cerkl
Ensembl Gene ENSMUSG00000075256
Gene Nameceramide kinase-like
SynonymsRp26
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.402) question?
Stock #R7874 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location79330543-79456785 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79338637 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 407 (R407S)
Ref Sequence ENSEMBL: ENSMUSP00000114325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143974] [ENSMUST00000156731]
Predicted Effect probably damaging
Transcript: ENSMUST00000143974
AA Change: R407S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114325
Gene: ENSMUSG00000075256
AA Change: R407S

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 70 80 N/A INTRINSIC
Pfam:DAGK_cat 152 293 2.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156731
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was initially identified as a locus (RP26) associated with an autosomal recessive form of retinitis pigmentosa (arRP) disease. This gene encodes a protein with ceramide kinase-like domains, however, the protein does not phosphorylate ceramide and its target substrate is currently unknown. This protein may be a negative regulator of apoptosis in photoreceptor cells. Mutations in this gene cause a form of retinitis pigmentosa characterized by autosomal recessive cone and rod dystrophy (arCRD). Alternative splicing of this gene results in multiple transcript variants encoding different isoforms and non-coding transcripts.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit retinal apoptosis and decreased amplitudes and increased implicit time of oscillatory potentials. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik C A 3: 6,620,141 K84N probably damaging Het
Aacs T C 5: 125,506,207 F276L possibly damaging Het
Aicda T A 6: 122,561,949 I179N probably damaging Het
Anks6 T A 4: 47,049,275 H210L unknown Het
Ano1 G A 7: 144,621,724 R486W probably damaging Het
Atp8b1 A G 18: 64,571,024 V341A probably benign Het
AY761184 C A 8: 21,702,796 R61S possibly damaging Het
Btn1a1 T C 13: 23,459,215 T355A possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Ceacam19 A T 7: 19,886,438 D89E probably damaging Het
Chl1 A G 6: 103,690,263 T389A probably benign Het
Dcn A G 10: 97,510,194 probably null Het
Dhtkd1 T C 2: 5,917,674 Q558R possibly damaging Het
Dhx36 C A 3: 62,488,631 V452L probably benign Het
Dlg5 A G 14: 24,135,619 V1906A probably damaging Het
Emc4 T C 2: 112,363,833 T159A probably damaging Het
Fstl5 C A 3: 76,661,786 P582Q probably benign Het
Gm960 C T 19: 4,658,423 C347Y probably damaging Het
Izumo1r T A 9: 14,900,579 Y171F probably benign Het
Jag2 C T 12: 112,915,946 V401M probably damaging Het
Jph2 C T 2: 163,375,842 G305S probably damaging Het
Kbtbd13 C A 9: 65,390,302 V451L probably benign Het
Map3k12 T C 15: 102,500,642 T813A possibly damaging Het
Mast4 A G 13: 102,739,275 L1295P probably damaging Het
Mia2 T A 12: 59,108,588 D362E probably damaging Het
Mospd3 T C 5: 137,600,028 Y77C probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Mup8 T A 4: 60,222,420 H17L probably damaging Het
Naip2 C T 13: 100,154,951 D1160N not run Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Ndnf A T 6: 65,703,429 M231L probably benign Het
Obscn T G 11: 59,133,276 T523P probably damaging Het
Olfr325 T C 11: 58,581,747 V301A possibly damaging Het
P4htm G T 9: 108,596,949 A130E probably benign Het
Phc3 A T 3: 30,936,714 D439E probably benign Het
Phlpp1 A G 1: 106,389,873 I1275V probably benign Het
Poln A T 5: 34,024,350 I719N probably damaging Het
Ptch2 T A 4: 117,105,964 L216Q possibly damaging Het
Rarres2 T A 6: 48,572,145 K41N probably benign Het
Rasal3 C T 17: 32,396,707 E386K possibly damaging Het
Rev3l T C 10: 39,822,495 I996T possibly damaging Het
Rreb1 A G 13: 37,947,124 N36S probably damaging Het
Serpinb9d T A 13: 33,202,671 probably null Het
Slc14a2 A G 18: 78,160,768 V526A probably benign Het
Slc45a4 T C 15: 73,584,335 probably null Het
Srrm2 G A 17: 23,815,678 R432H unknown Het
Svs1 A G 6: 48,988,666 N536S possibly damaging Het
Th G A 7: 142,895,571 R266* probably null Het
Tln1 T C 4: 43,538,041 Y1853C probably damaging Het
Tln1 A T 4: 43,555,606 D169E probably damaging Het
Tmcc3 G A 10: 94,551,027 probably null Het
Tnxb A G 17: 34,711,443 E2034G probably damaging Het
Ttc4 T C 4: 106,665,684 T346A probably benign Het
Vmn2r5 A T 3: 64,491,032 V842E probably damaging Het
Vmn2r82 T G 10: 79,396,511 N781K probably damaging Het
Zdhhc17 A T 10: 110,982,117 Y67N possibly damaging Het
Zfp273 A G 13: 67,825,439 T229A probably benign Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Zswim8 A G 14: 20,723,149 H1769R probably damaging Het
Zzef1 T C 11: 72,859,653 V929A probably benign Het
Other mutations in Cerkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Cerkl APN 2 79341499 missense probably benign 0.00
IGL01330:Cerkl APN 2 79368781 missense possibly damaging 0.90
IGL01468:Cerkl APN 2 79343215 critical splice donor site probably null
IGL01946:Cerkl APN 2 79393020 missense probably benign 0.19
IGL02027:Cerkl APN 2 79341286 unclassified probably benign
IGL02809:Cerkl APN 2 79342202 missense possibly damaging 0.54
IGL03293:Cerkl APN 2 79342375 missense probably damaging 0.98
R0076:Cerkl UTSW 2 79343289 missense possibly damaging 0.93
R0453:Cerkl UTSW 2 79342451 missense probably benign 0.25
R0918:Cerkl UTSW 2 79333629 missense probably benign 0.00
R1533:Cerkl UTSW 2 79341357 missense possibly damaging 0.94
R4003:Cerkl UTSW 2 79428794 missense possibly damaging 0.86
R5078:Cerkl UTSW 2 79393008 missense probably benign 0.29
R5093:Cerkl UTSW 2 79333523 missense probably damaging 1.00
R5431:Cerkl UTSW 2 79341335 missense probably damaging 1.00
R5522:Cerkl UTSW 2 79392984 missense probably benign 0.44
R6249:Cerkl UTSW 2 79368778 missense probably damaging 1.00
R7036:Cerkl UTSW 2 79341378 missense probably benign 0.03
R7201:Cerkl UTSW 2 79333590 missense probably benign 0.00
R7326:Cerkl UTSW 2 79332605 missense probably benign 0.37
R7343:Cerkl UTSW 2 79428760 missense probably damaging 1.00
R7833:Cerkl UTSW 2 79341380 missense probably benign 0.01
R8190:Cerkl UTSW 2 79333557 missense probably benign 0.17
R8333:Cerkl UTSW 2 79338578 missense possibly damaging 0.65
Z1176:Cerkl UTSW 2 79368765 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTTTCTCACAAGACTAAACTTGAC -3'
(R):5'- TTTTGCTGAGAAGAAACCCCAG -3'

Sequencing Primer
(F):5'- ACTTGACATTAATCTCTGAAGCATC -3'
(R):5'- CCCCAGGGACTAATAAAACTAATTTG -3'
Posted On2019-12-20