Incidental Mutation 'R7874:Vmn2r5'
ID608304
Institutional Source Beutler Lab
Gene Symbol Vmn2r5
Ensembl Gene ENSMUSG00000068999
Gene Namevomeronasal 2, receptor 5
SynonymsEG667060
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R7874 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location64490821-64509735 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64491032 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 842 (V842E)
Ref Sequence ENSEMBL: ENSMUSP00000135592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170270] [ENSMUST00000177184]
Predicted Effect probably damaging
Transcript: ENSMUST00000170270
AA Change: V755E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131925
Gene: ENSMUSG00000068999
AA Change: V755E

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 9.9e-78 PFAM
Pfam:NCD3G 458 511 8.5e-18 PFAM
Pfam:7tm_3 542 779 2.3e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177184
AA Change: V842E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135592
Gene: ENSMUSG00000068999
AA Change: V842E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 86 503 1.8e-80 PFAM
Pfam:NCD3G 545 598 1e-14 PFAM
Pfam:7tm_3 631 865 1.4e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik C A 3: 6,620,141 K84N probably damaging Het
Aacs T C 5: 125,506,207 F276L possibly damaging Het
Aicda T A 6: 122,561,949 I179N probably damaging Het
Anks6 T A 4: 47,049,275 H210L unknown Het
Ano1 G A 7: 144,621,724 R486W probably damaging Het
Atp8b1 A G 18: 64,571,024 V341A probably benign Het
AY761184 C A 8: 21,702,796 R61S possibly damaging Het
Btn1a1 T C 13: 23,459,215 T355A possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Ceacam19 A T 7: 19,886,438 D89E probably damaging Het
Cerkl T A 2: 79,338,637 R407S probably damaging Het
Chl1 A G 6: 103,690,263 T389A probably benign Het
Dcn A G 10: 97,510,194 probably null Het
Dhtkd1 T C 2: 5,917,674 Q558R possibly damaging Het
Dhx36 C A 3: 62,488,631 V452L probably benign Het
Dlg5 A G 14: 24,135,619 V1906A probably damaging Het
Emc4 T C 2: 112,363,833 T159A probably damaging Het
Fstl5 C A 3: 76,661,786 P582Q probably benign Het
Gm960 C T 19: 4,658,423 C347Y probably damaging Het
Izumo1r T A 9: 14,900,579 Y171F probably benign Het
Jag2 C T 12: 112,915,946 V401M probably damaging Het
Jph2 C T 2: 163,375,842 G305S probably damaging Het
Kbtbd13 C A 9: 65,390,302 V451L probably benign Het
Map3k12 T C 15: 102,500,642 T813A possibly damaging Het
Mast4 A G 13: 102,739,275 L1295P probably damaging Het
Mia2 T A 12: 59,108,588 D362E probably damaging Het
Mospd3 T C 5: 137,600,028 Y77C probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Mup8 T A 4: 60,222,420 H17L probably damaging Het
Naip2 C T 13: 100,154,951 D1160N not run Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Ndnf A T 6: 65,703,429 M231L probably benign Het
Obscn T G 11: 59,133,276 T523P probably damaging Het
Olfr325 T C 11: 58,581,747 V301A possibly damaging Het
P4htm G T 9: 108,596,949 A130E probably benign Het
Phc3 A T 3: 30,936,714 D439E probably benign Het
Phlpp1 A G 1: 106,389,873 I1275V probably benign Het
Poln A T 5: 34,024,350 I719N probably damaging Het
Ptch2 T A 4: 117,105,964 L216Q possibly damaging Het
Rarres2 T A 6: 48,572,145 K41N probably benign Het
Rasal3 C T 17: 32,396,707 E386K possibly damaging Het
Rev3l T C 10: 39,822,495 I996T possibly damaging Het
Rreb1 A G 13: 37,947,124 N36S probably damaging Het
Serpinb9d T A 13: 33,202,671 probably null Het
Slc14a2 A G 18: 78,160,768 V526A probably benign Het
Slc45a4 T C 15: 73,584,335 probably null Het
Srrm2 G A 17: 23,815,678 R432H unknown Het
Svs1 A G 6: 48,988,666 N536S possibly damaging Het
Th G A 7: 142,895,571 R266* probably null Het
Tln1 T C 4: 43,538,041 Y1853C probably damaging Het
Tln1 A T 4: 43,555,606 D169E probably damaging Het
Tmcc3 G A 10: 94,551,027 probably null Het
Tnxb A G 17: 34,711,443 E2034G probably damaging Het
Ttc4 T C 4: 106,665,684 T346A probably benign Het
Vmn2r82 T G 10: 79,396,511 N781K probably damaging Het
Zdhhc17 A T 10: 110,982,117 Y67N possibly damaging Het
Zfp273 A G 13: 67,825,439 T229A probably benign Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Zswim8 A G 14: 20,723,149 H1769R probably damaging Het
Zzef1 T C 11: 72,859,653 V929A probably benign Het
Other mutations in Vmn2r5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Vmn2r5 APN 3 64491413 missense possibly damaging 0.67
IGL01139:Vmn2r5 APN 3 64491405 missense probably benign 0.28
IGL03293:Vmn2r5 APN 3 64491326 missense probably benign 0.01
PIT4581001:Vmn2r5 UTSW 3 64503927 nonsense probably null
R0063:Vmn2r5 UTSW 3 64503800 missense probably benign 0.01
R0142:Vmn2r5 UTSW 3 64492588 missense probably damaging 1.00
R0193:Vmn2r5 UTSW 3 64491530 missense possibly damaging 0.91
R0219:Vmn2r5 UTSW 3 64504313 missense probably damaging 0.99
R0313:Vmn2r5 UTSW 3 64503827 missense probably benign
R0620:Vmn2r5 UTSW 3 64503814 nonsense probably null
R0726:Vmn2r5 UTSW 3 64503765 missense probably benign 0.01
R1073:Vmn2r5 UTSW 3 64491305 nonsense probably null
R1549:Vmn2r5 UTSW 3 64504000 missense probably damaging 1.00
R1581:Vmn2r5 UTSW 3 64491219 missense probably damaging 1.00
R1624:Vmn2r5 UTSW 3 64509695 missense probably benign 0.19
R1973:Vmn2r5 UTSW 3 64504221 missense probably damaging 1.00
R1974:Vmn2r5 UTSW 3 64504221 missense probably damaging 1.00
R1975:Vmn2r5 UTSW 3 64504221 missense probably damaging 1.00
R1977:Vmn2r5 UTSW 3 64504221 missense probably damaging 1.00
R2189:Vmn2r5 UTSW 3 64509593 missense probably benign 0.27
R2484:Vmn2r5 UTSW 3 64503971 missense possibly damaging 0.94
R4573:Vmn2r5 UTSW 3 64503918 missense probably damaging 0.98
R5243:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5384:Vmn2r5 UTSW 3 64509510 missense probably benign 0.02
R5385:Vmn2r5 UTSW 3 64509510 missense probably benign 0.02
R5587:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5588:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5589:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5590:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5739:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R6113:Vmn2r5 UTSW 3 64491399 missense probably benign 0.03
R6739:Vmn2r5 UTSW 3 64491216 missense probably damaging 0.97
R7106:Vmn2r5 UTSW 3 64491683 missense probably benign 0.05
R7304:Vmn2r5 UTSW 3 64504250 missense probably damaging 0.97
R7402:Vmn2r5 UTSW 3 64495755 missense probably benign 0.05
R7477:Vmn2r5 UTSW 3 64491639 missense probably damaging 1.00
R7571:Vmn2r5 UTSW 3 64504404 missense probably damaging 1.00
R7678:Vmn2r5 UTSW 3 64509522 missense probably benign
R7957:Vmn2r5 UTSW 3 64491032 missense probably damaging 1.00
R8110:Vmn2r5 UTSW 3 64491288 missense probably benign 0.00
R8223:Vmn2r5 UTSW 3 64491305 nonsense probably null
Z1088:Vmn2r5 UTSW 3 64509542 missense probably benign 0.02
Z1177:Vmn2r5 UTSW 3 64491051 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTACTCATCCAGAACAGTGG -3'
(R):5'- TACTTGGTGTTGGAGCCTCC -3'

Sequencing Primer
(F):5'- TGGATGCTCCTGTCAACA -3'
(R):5'- CATCTTTGAATGCAGTGAAGGTTC -3'
Posted On2019-12-20