Incidental Mutation 'R7874:Svs1'
ID608318
Institutional Source Beutler Lab
Gene Symbol Svs1
Ensembl Gene ENSMUSG00000039215
Gene Nameseminal vesicle secretory protein 1
SynonymsSVS I
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R7874 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location48986861-48991722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48988666 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 536 (N536S)
Ref Sequence ENSEMBL: ENSMUSP00000045221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037696]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037696
AA Change: N536S

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045221
Gene: ENSMUSG00000039215
AA Change: N536S

DomainStartEndE-ValueType
Pfam:Cu_amine_oxidN2 44 130 1.5e-24 PFAM
Pfam:Cu_amine_oxidN3 146 246 2.7e-16 PFAM
internal_repeat_1 286 342 7.28e-22 PROSPERO
Pfam:Cu_amine_oxid 408 811 2e-92 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik C A 3: 6,620,141 K84N probably damaging Het
Aacs T C 5: 125,506,207 F276L possibly damaging Het
Aicda T A 6: 122,561,949 I179N probably damaging Het
Anks6 T A 4: 47,049,275 H210L unknown Het
Ano1 G A 7: 144,621,724 R486W probably damaging Het
Atp8b1 A G 18: 64,571,024 V341A probably benign Het
AY761184 C A 8: 21,702,796 R61S possibly damaging Het
Btn1a1 T C 13: 23,459,215 T355A possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Ceacam19 A T 7: 19,886,438 D89E probably damaging Het
Cerkl T A 2: 79,338,637 R407S probably damaging Het
Chl1 A G 6: 103,690,263 T389A probably benign Het
Dcn A G 10: 97,510,194 probably null Het
Dhtkd1 T C 2: 5,917,674 Q558R possibly damaging Het
Dhx36 C A 3: 62,488,631 V452L probably benign Het
Dlg5 A G 14: 24,135,619 V1906A probably damaging Het
Emc4 T C 2: 112,363,833 T159A probably damaging Het
Fstl5 C A 3: 76,661,786 P582Q probably benign Het
Gm960 C T 19: 4,658,423 C347Y probably damaging Het
Izumo1r T A 9: 14,900,579 Y171F probably benign Het
Jag2 C T 12: 112,915,946 V401M probably damaging Het
Jph2 C T 2: 163,375,842 G305S probably damaging Het
Kbtbd13 C A 9: 65,390,302 V451L probably benign Het
Map3k12 T C 15: 102,500,642 T813A possibly damaging Het
Mast4 A G 13: 102,739,275 L1295P probably damaging Het
Mia2 T A 12: 59,108,588 D362E probably damaging Het
Mospd3 T C 5: 137,600,028 Y77C probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Mup8 T A 4: 60,222,420 H17L probably damaging Het
Naip2 C T 13: 100,154,951 D1160N not run Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Ndnf A T 6: 65,703,429 M231L probably benign Het
Obscn T G 11: 59,133,276 T523P probably damaging Het
Olfr325 T C 11: 58,581,747 V301A possibly damaging Het
P4htm G T 9: 108,596,949 A130E probably benign Het
Phc3 A T 3: 30,936,714 D439E probably benign Het
Phlpp1 A G 1: 106,389,873 I1275V probably benign Het
Poln A T 5: 34,024,350 I719N probably damaging Het
Ptch2 T A 4: 117,105,964 L216Q possibly damaging Het
Rarres2 T A 6: 48,572,145 K41N probably benign Het
Rasal3 C T 17: 32,396,707 E386K possibly damaging Het
Rev3l T C 10: 39,822,495 I996T possibly damaging Het
Rreb1 A G 13: 37,947,124 N36S probably damaging Het
Serpinb9d T A 13: 33,202,671 probably null Het
Slc14a2 A G 18: 78,160,768 V526A probably benign Het
Slc45a4 T C 15: 73,584,335 probably null Het
Srrm2 G A 17: 23,815,678 R432H unknown Het
Th G A 7: 142,895,571 R266* probably null Het
Tln1 T C 4: 43,538,041 Y1853C probably damaging Het
Tln1 A T 4: 43,555,606 D169E probably damaging Het
Tmcc3 G A 10: 94,551,027 probably null Het
Tnxb A G 17: 34,711,443 E2034G probably damaging Het
Ttc4 T C 4: 106,665,684 T346A probably benign Het
Vmn2r5 A T 3: 64,491,032 V842E probably damaging Het
Vmn2r82 T G 10: 79,396,511 N781K probably damaging Het
Zdhhc17 A T 10: 110,982,117 Y67N possibly damaging Het
Zfp273 A G 13: 67,825,439 T229A probably benign Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Zswim8 A G 14: 20,723,149 H1769R probably damaging Het
Zzef1 T C 11: 72,859,653 V929A probably benign Het
Other mutations in Svs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Svs1 APN 6 48987739 missense probably damaging 0.98
IGL01876:Svs1 APN 6 48990036 missense possibly damaging 0.71
IGL01934:Svs1 APN 6 48988761 missense probably damaging 0.97
IGL03002:Svs1 APN 6 48987118 missense probably benign 0.01
IGL03059:Svs1 APN 6 48987415 missense probably benign 0.13
IGL03213:Svs1 APN 6 48988345 missense possibly damaging 0.92
IGL03249:Svs1 APN 6 48988369 missense probably benign
IGL03365:Svs1 APN 6 48988597 missense probably damaging 0.97
PIT4280001:Svs1 UTSW 6 48987120 missense probably benign 0.01
PIT4495001:Svs1 UTSW 6 48987776 missense possibly damaging 0.92
R0010:Svs1 UTSW 6 48988906 missense probably damaging 0.99
R0528:Svs1 UTSW 6 48988031 missense probably benign
R0784:Svs1 UTSW 6 48987301 missense possibly damaging 0.78
R0959:Svs1 UTSW 6 48988632 missense possibly damaging 0.89
R1173:Svs1 UTSW 6 48990239 missense probably damaging 1.00
R1174:Svs1 UTSW 6 48990239 missense probably damaging 1.00
R1175:Svs1 UTSW 6 48990239 missense probably damaging 1.00
R1940:Svs1 UTSW 6 48990073 nonsense probably null
R3115:Svs1 UTSW 6 48987397 missense probably damaging 0.99
R3116:Svs1 UTSW 6 48987397 missense probably damaging 0.99
R3808:Svs1 UTSW 6 48987994 missense possibly damaging 0.93
R3809:Svs1 UTSW 6 48987994 missense possibly damaging 0.93
R3852:Svs1 UTSW 6 48987994 missense possibly damaging 0.93
R4455:Svs1 UTSW 6 48987460 missense possibly damaging 0.56
R4898:Svs1 UTSW 6 48987717 missense possibly damaging 0.95
R4933:Svs1 UTSW 6 48987492 missense probably damaging 1.00
R5108:Svs1 UTSW 6 48988570 missense probably damaging 0.97
R5320:Svs1 UTSW 6 48987575 missense probably benign 0.02
R6053:Svs1 UTSW 6 48988488 missense probably benign 0.42
R6728:Svs1 UTSW 6 48988845 missense possibly damaging 0.86
R6922:Svs1 UTSW 6 48987574 missense probably damaging 0.99
R7045:Svs1 UTSW 6 48988612 missense possibly damaging 0.81
R7046:Svs1 UTSW 6 48987578 missense probably benign 0.11
R7137:Svs1 UTSW 6 48990149 missense probably damaging 1.00
R7267:Svs1 UTSW 6 48988018 small deletion probably benign
R7993:Svs1 UTSW 6 48987608 missense possibly damaging 0.85
R8238:Svs1 UTSW 6 48990041 missense probably damaging 0.96
X0022:Svs1 UTSW 6 48988339 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCAAGAGGTTATGGCAC -3'
(R):5'- AAGTGGCATGAACATACCCG -3'

Sequencing Primer
(F):5'- TTATGGCACTGTATAGAGGACACAC -3'
(R):5'- ATACCCGGTGGCGTACATCTTG -3'
Posted On2019-12-20