Incidental Mutation 'R7874:Ceacam19'
ID608322
Institutional Source Beutler Lab
Gene Symbol Ceacam19
Ensembl Gene ENSMUSG00000049848
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 19
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7874 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location19875742-19887965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19886438 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 89 (D89E)
Ref Sequence ENSEMBL: ENSMUSP00000057433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052605]
Predicted Effect probably damaging
Transcript: ENSMUST00000052605
AA Change: D89E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057433
Gene: ENSMUSG00000049848
AA Change: D89E

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
IG 37 140 3.83e0 SMART
transmembrane domain 157 179 N/A INTRINSIC
low complexity region 227 249 N/A INTRINSIC
Meta Mutation Damage Score 0.1647 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik C A 3: 6,620,141 K84N probably damaging Het
Aacs T C 5: 125,506,207 F276L possibly damaging Het
Aicda T A 6: 122,561,949 I179N probably damaging Het
Anks6 T A 4: 47,049,275 H210L unknown Het
Ano1 G A 7: 144,621,724 R486W probably damaging Het
Atp8b1 A G 18: 64,571,024 V341A probably benign Het
AY761184 C A 8: 21,702,796 R61S possibly damaging Het
Btn1a1 T C 13: 23,459,215 T355A possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cerkl T A 2: 79,338,637 R407S probably damaging Het
Chl1 A G 6: 103,690,263 T389A probably benign Het
Dcn A G 10: 97,510,194 probably null Het
Dhtkd1 T C 2: 5,917,674 Q558R possibly damaging Het
Dhx36 C A 3: 62,488,631 V452L probably benign Het
Dlg5 A G 14: 24,135,619 V1906A probably damaging Het
Emc4 T C 2: 112,363,833 T159A probably damaging Het
Fstl5 C A 3: 76,661,786 P582Q probably benign Het
Gm960 C T 19: 4,658,423 C347Y probably damaging Het
Izumo1r T A 9: 14,900,579 Y171F probably benign Het
Jag2 C T 12: 112,915,946 V401M probably damaging Het
Jph2 C T 2: 163,375,842 G305S probably damaging Het
Kbtbd13 C A 9: 65,390,302 V451L probably benign Het
Map3k12 T C 15: 102,500,642 T813A possibly damaging Het
Mast4 A G 13: 102,739,275 L1295P probably damaging Het
Mia2 T A 12: 59,108,588 D362E probably damaging Het
Mospd3 T C 5: 137,600,028 Y77C probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Mup8 T A 4: 60,222,420 H17L probably damaging Het
Naip2 C T 13: 100,154,951 D1160N not run Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Ndnf A T 6: 65,703,429 M231L probably benign Het
Obscn T G 11: 59,133,276 T523P probably damaging Het
Olfr325 T C 11: 58,581,747 V301A possibly damaging Het
P4htm G T 9: 108,596,949 A130E probably benign Het
Phc3 A T 3: 30,936,714 D439E probably benign Het
Phlpp1 A G 1: 106,389,873 I1275V probably benign Het
Poln A T 5: 34,024,350 I719N probably damaging Het
Ptch2 T A 4: 117,105,964 L216Q possibly damaging Het
Rarres2 T A 6: 48,572,145 K41N probably benign Het
Rasal3 C T 17: 32,396,707 E386K possibly damaging Het
Rev3l T C 10: 39,822,495 I996T possibly damaging Het
Rreb1 A G 13: 37,947,124 N36S probably damaging Het
Serpinb9d T A 13: 33,202,671 probably null Het
Slc14a2 A G 18: 78,160,768 V526A probably benign Het
Slc45a4 T C 15: 73,584,335 probably null Het
Srrm2 G A 17: 23,815,678 R432H unknown Het
Svs1 A G 6: 48,988,666 N536S possibly damaging Het
Th G A 7: 142,895,571 R266* probably null Het
Tln1 T C 4: 43,538,041 Y1853C probably damaging Het
Tln1 A T 4: 43,555,606 D169E probably damaging Het
Tmcc3 G A 10: 94,551,027 probably null Het
Tnxb A G 17: 34,711,443 E2034G probably damaging Het
Ttc4 T C 4: 106,665,684 T346A probably benign Het
Vmn2r5 A T 3: 64,491,032 V842E probably damaging Het
Vmn2r82 T G 10: 79,396,511 N781K probably damaging Het
Zdhhc17 A T 10: 110,982,117 Y67N possibly damaging Het
Zfp273 A G 13: 67,825,439 T229A probably benign Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Zswim8 A G 14: 20,723,149 H1769R probably damaging Het
Zzef1 T C 11: 72,859,653 V929A probably benign Het
Other mutations in Ceacam19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02826:Ceacam19 APN 7 19882610 missense probably benign 0.20
R0791:Ceacam19 UTSW 7 19882632 splice site probably null
R6084:Ceacam19 UTSW 7 19882887 missense probably benign 0.00
R6492:Ceacam19 UTSW 7 19882592 missense probably benign 0.00
R7596:Ceacam19 UTSW 7 19881887 missense possibly damaging 0.90
R7734:Ceacam19 UTSW 7 19886595 missense probably benign 0.00
Z1177:Ceacam19 UTSW 7 19882844 missense probably damaging 0.99
Z1177:Ceacam19 UTSW 7 19886449 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGATGCTCAATCAATGCAC -3'
(R):5'- CCACATCGAGATGATCCCAGAG -3'

Sequencing Primer
(F):5'- CTAAATGGCATGGTCTTTGCAC -3'
(R):5'- GAGATGATCCCAGAGCAGCCTC -3'
Posted On2019-12-20