Incidental Mutation 'R0147:Ddx39a'
ID 60834
Institutional Source Beutler Lab
Gene Symbol Ddx39a
Ensembl Gene ENSMUSG00000005481
Gene Name DEAD box helicase 39a
Synonyms BAT1, 2610307C23Rik, Ddx39
MMRRC Submission 038431-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.930) question?
Stock # R0147 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 84441806-84453521 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 84449105 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 298 (R298C)
Ref Sequence ENSEMBL: ENSMUSP00000148329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002964] [ENSMUST00000019576] [ENSMUST00000075843] [ENSMUST00000109802] [ENSMUST00000109810] [ENSMUST00000140521] [ENSMUST00000172396] [ENSMUST00000212949] [ENSMUST00000166939]
AlphaFold Q8VDW0
Predicted Effect probably benign
Transcript: ENSMUST00000002964
SMART Domains Protein: ENSMUSP00000002964
Gene: ENSMUSG00000002885

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 120 167 1.78e-11 SMART
GPS 384 430 2.18e-8 SMART
Pfam:Dicty_CAR 431 703 1.3e-8 PFAM
Pfam:7tm_2 432 672 8.1e-68 PFAM
low complexity region 704 714 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000019576
AA Change: R298C

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000019576
Gene: ENSMUSG00000005481
AA Change: R298C

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 264 4.06e-54 SMART
HELICc 300 381 9.09e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075843
SMART Domains Protein: ENSMUSP00000075240
Gene: ENSMUSG00000002885

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 165 213 1.38e-8 SMART
EGF_CA 214 261 1.78e-11 SMART
GPS 478 524 2.18e-8 SMART
Pfam:Dicty_CAR 525 798 4.6e-8 PFAM
Pfam:7tm_2 526 766 5.3e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109802
SMART Domains Protein: ENSMUSP00000105427
Gene: ENSMUSG00000002885

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 120 168 1.38e-8 SMART
EGF_CA 169 216 1.78e-11 SMART
GPS 433 479 2.18e-8 SMART
Pfam:Dicty_CAR 480 752 5.3e-8 PFAM
Pfam:7tm_2 481 721 7.5e-67 PFAM
low complexity region 753 763 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109810
AA Change: R298C

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105435
Gene: ENSMUSG00000005481
AA Change: R298C

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 264 4.06e-54 SMART
HELICc 300 381 9.09e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139797
Predicted Effect probably benign
Transcript: ENSMUST00000140521
SMART Domains Protein: ENSMUSP00000116101
Gene: ENSMUSG00000005481

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 208 2.82e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000172396
AA Change: R298C

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132222
Gene: ENSMUSG00000005481
AA Change: R298C

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 264 4.06e-54 SMART
HELICc 300 381 9.09e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000212949
AA Change: R298C

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184114
Predicted Effect probably benign
Transcript: ENSMUST00000166939
SMART Domains Protein: ENSMUSP00000128220
Gene: ENSMUSG00000002885

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
EGF 28 66 1.63e1 SMART
EGF_CA 67 117 5.92e-8 SMART
EGF_CA 118 165 1.78e-11 SMART
GPS 382 428 2.18e-8 SMART
Pfam:Dicty_CAR 429 701 2.1e-7 PFAM
Pfam:7tm_2 430 670 1.7e-66 PFAM
low complexity region 702 712 N/A INTRINSIC
Meta Mutation Damage Score 0.8889 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 94.5%
  • 20x: 86.1%
Validation Efficiency 67% (88/131)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. These proteins are characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD) and are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene is thought to play a role in the prognosis of patients with gastrointestinal stromal tumors. A pseudogene of this gene is present on chromosome 13. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,639,405 (GRCm39) probably null Het
Abtb2 A G 2: 103,397,480 (GRCm39) I137V probably benign Het
Ank1 T A 8: 23,613,993 (GRCm39) N1545K probably damaging Het
Arl6 T C 16: 59,439,153 (GRCm39) probably benign Het
Avl9 T A 6: 56,713,487 (GRCm39) D248E probably benign Het
Becn1 T C 11: 101,192,562 (GRCm39) E40G probably damaging Het
Bod1l G T 5: 41,976,040 (GRCm39) A1758E possibly damaging Het
Btbd16 C T 7: 130,381,324 (GRCm39) T19I probably damaging Het
Casc3 T A 11: 98,713,325 (GRCm39) N246K possibly damaging Het
Celf1 G T 2: 90,835,035 (GRCm39) probably benign Het
Chrm3 G T 13: 9,928,780 (GRCm39) N85K probably damaging Het
Cluh T A 11: 74,556,764 (GRCm39) Y935N probably damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Col6a5 T C 9: 105,802,993 (GRCm39) D1324G unknown Het
Ctcfl T C 2: 172,960,340 (GRCm39) D81G possibly damaging Het
D630003M21Rik C T 2: 158,044,987 (GRCm39) probably benign Het
Dnmt3b T G 2: 153,503,377 (GRCm39) N9K possibly damaging Het
Dock8 T C 19: 25,096,823 (GRCm39) L577P probably benign Het
Drc1 A T 5: 30,486,487 (GRCm39) N13I possibly damaging Het
Eml4 T A 17: 83,729,081 (GRCm39) N85K probably damaging Het
Epb41l4a T C 18: 33,931,853 (GRCm39) T581A probably damaging Het
Epha3 T C 16: 63,433,307 (GRCm39) D446G possibly damaging Het
Fam209 G T 2: 172,315,900 (GRCm39) G92C probably damaging Het
Fam98c T A 7: 28,852,146 (GRCm39) R340* probably null Het
Fbxw10 T G 11: 62,738,307 (GRCm39) probably null Het
Galr1 A G 18: 82,423,695 (GRCm39) L194P probably benign Het
Gar1 T C 3: 129,623,122 (GRCm39) H89R probably damaging Het
Gbp4 T A 5: 105,267,362 (GRCm39) Y519F probably benign Het
Gm28042 T A 2: 119,866,944 (GRCm39) S196T probably benign Het
Grid2 T C 6: 64,510,571 (GRCm39) Y734H probably benign Het
Grm6 T A 11: 50,750,144 (GRCm39) I466N possibly damaging Het
Hectd3 T C 4: 116,854,237 (GRCm39) probably benign Het
Hpse2 A C 19: 42,920,099 (GRCm39) probably null Het
Hspb7 T C 4: 141,151,302 (GRCm39) I148T probably damaging Het
Htr1d C A 4: 136,170,788 (GRCm39) T339K probably damaging Het
Ip6k1 T A 9: 107,923,093 (GRCm39) D408E probably damaging Het
Irs2 A T 8: 11,057,568 (GRCm39) M288K probably damaging Het
Kansl3 A T 1: 36,392,897 (GRCm39) C225S probably damaging Het
Knop1 C A 7: 118,445,061 (GRCm39) R301L probably benign Het
Lama5 T C 2: 179,832,199 (GRCm39) H1714R probably benign Het
Mettl14 G A 3: 123,165,043 (GRCm39) T316I probably damaging Het
Mmp15 A T 8: 96,098,945 (GRCm39) N591Y probably benign Het
Mprip T A 11: 59,627,899 (GRCm39) D93E possibly damaging Het
Mtmr14 T A 6: 113,237,627 (GRCm39) probably benign Het
Muc5ac T C 7: 141,364,776 (GRCm39) S1917P probably benign Het
Muc6 C T 7: 141,238,255 (GRCm39) C75Y probably damaging Het
Naip1 A T 13: 100,563,418 (GRCm39) H582Q possibly damaging Het
Nbeal2 G A 9: 110,471,211 (GRCm39) R264* probably null Het
Neb T C 2: 52,139,388 (GRCm39) K140E probably damaging Het
Nfya A G 17: 48,706,026 (GRCm39) V48A possibly damaging Het
Ngf G T 3: 102,417,119 (GRCm39) probably benign Het
Nsmce2 T G 15: 59,250,806 (GRCm39) S26A probably damaging Het
Or52s19 T C 7: 103,007,613 (GRCm39) T263A possibly damaging Het
Or5m13b T A 2: 85,754,362 (GRCm39) I250N possibly damaging Het
Or7e177 T G 9: 20,212,387 (GRCm39) M297R probably damaging Het
Pax1 A G 2: 147,215,654 (GRCm39) S424G probably benign Het
Pcdhb19 A T 18: 37,630,235 (GRCm39) Q10L probably benign Het
Pdcl T C 2: 37,242,142 (GRCm39) I203V probably benign Het
Pknox1 T A 17: 31,823,764 (GRCm39) N379K probably benign Het
Plxna1 C T 6: 89,297,692 (GRCm39) A1831T possibly damaging Het
Prodh T G 16: 17,895,677 (GRCm39) Q360P probably damaging Het
Pygo2 T C 3: 89,340,610 (GRCm39) V299A probably damaging Het
Raf1 C T 6: 115,609,934 (GRCm39) G202S probably benign Het
Rgs11 T A 17: 26,426,433 (GRCm39) probably null Het
Rmc1 C T 18: 12,322,328 (GRCm39) R594C probably damaging Het
Rnf13 A G 3: 57,709,889 (GRCm39) D144G probably damaging Het
Rtel1 T C 2: 180,962,839 (GRCm39) C31R probably damaging Het
Rubcnl T A 14: 75,279,898 (GRCm39) I427K probably damaging Het
Sec23ip C T 7: 128,380,775 (GRCm39) probably benign Het
Slc25a26 T A 6: 94,569,507 (GRCm39) probably null Het
Slc6a7 A G 18: 61,135,183 (GRCm39) probably benign Het
Slco6b1 A T 1: 96,915,562 (GRCm39) noncoding transcript Het
Spata17 A G 1: 186,844,798 (GRCm39) V111A probably damaging Het
Spata22 T A 11: 73,221,979 (GRCm39) M1K probably null Het
Svep1 C T 4: 58,116,608 (GRCm39) D881N possibly damaging Het
Sypl2 T A 3: 108,126,411 (GRCm39) N67I possibly damaging Het
Tasor A G 14: 27,193,725 (GRCm39) D975G probably benign Het
Tenm3 T C 8: 48,689,755 (GRCm39) Y1944C probably damaging Het
Tm9sf4 G T 2: 153,037,233 (GRCm39) V365L probably benign Het
Tmc3 T C 7: 83,256,950 (GRCm39) V401A probably damaging Het
Trpm2 C T 10: 77,761,659 (GRCm39) G997D probably damaging Het
Unc5b A T 10: 60,608,076 (GRCm39) S675T probably damaging Het
Vmn1r217 A G 13: 23,298,107 (GRCm39) M265T probably benign Het
Vps54 T A 11: 21,250,259 (GRCm39) D548E probably benign Het
Wdfy3 A G 5: 102,065,277 (GRCm39) V1297A probably benign Het
Wdr46 T A 17: 34,159,997 (GRCm39) F70I probably benign Het
Zdbf2 C T 1: 63,343,165 (GRCm39) Q515* probably null Het
Zfp710 T A 7: 79,731,721 (GRCm39) C299* probably null Het
Other mutations in Ddx39a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02544:Ddx39a APN 8 84,449,402 (GRCm39) missense probably benign 0.03
IGL02712:Ddx39a APN 8 84,448,386 (GRCm39) missense probably benign 0.03
R0038:Ddx39a UTSW 8 84,449,127 (GRCm39) missense probably damaging 1.00
R0038:Ddx39a UTSW 8 84,449,127 (GRCm39) missense probably damaging 1.00
R0051:Ddx39a UTSW 8 84,447,251 (GRCm39) missense possibly damaging 0.83
R0051:Ddx39a UTSW 8 84,447,251 (GRCm39) missense possibly damaging 0.83
R0143:Ddx39a UTSW 8 84,447,179 (GRCm39) missense probably benign 0.22
R0148:Ddx39a UTSW 8 84,449,105 (GRCm39) missense possibly damaging 0.74
R0392:Ddx39a UTSW 8 84,448,366 (GRCm39) missense probably damaging 0.97
R0426:Ddx39a UTSW 8 84,448,398 (GRCm39) missense probably benign 0.00
R0830:Ddx39a UTSW 8 84,446,452 (GRCm39) missense possibly damaging 0.47
R1509:Ddx39a UTSW 8 84,446,527 (GRCm39) missense probably damaging 1.00
R2935:Ddx39a UTSW 8 84,447,587 (GRCm39) missense possibly damaging 0.57
R3082:Ddx39a UTSW 8 84,449,335 (GRCm39) missense possibly damaging 0.57
R4050:Ddx39a UTSW 8 84,448,863 (GRCm39) missense probably benign 0.00
R4647:Ddx39a UTSW 8 84,448,902 (GRCm39) missense probably benign 0.00
R4804:Ddx39a UTSW 8 84,447,724 (GRCm39) missense probably damaging 0.99
R5242:Ddx39a UTSW 8 84,448,440 (GRCm39) missense probably benign 0.01
R5268:Ddx39a UTSW 8 84,448,950 (GRCm39) missense probably benign 0.08
R6598:Ddx39a UTSW 8 84,449,556 (GRCm39) missense probably benign 0.03
R6805:Ddx39a UTSW 8 84,449,766 (GRCm39) missense probably damaging 1.00
R6852:Ddx39a UTSW 8 84,449,646 (GRCm39) missense probably benign 0.03
R7326:Ddx39a UTSW 8 84,449,100 (GRCm39) missense probably benign 0.31
R7559:Ddx39a UTSW 8 84,447,595 (GRCm39) missense possibly damaging 0.82
R7803:Ddx39a UTSW 8 84,446,229 (GRCm39) critical splice donor site probably null
R8103:Ddx39a UTSW 8 84,451,105 (GRCm39) critical splice acceptor site probably null
R9187:Ddx39a UTSW 8 84,449,113 (GRCm39) missense probably benign
R9483:Ddx39a UTSW 8 84,448,916 (GRCm39) missense probably benign 0.14
R9631:Ddx39a UTSW 8 84,447,729 (GRCm39) missense possibly damaging 0.92
X0026:Ddx39a UTSW 8 84,448,959 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGAACCGTAAGCTCTTCGACCTCC -3'
(R):5'- TGCCAAACAGATTAGTAGCCACCAG -3'

Sequencing Primer
(F):5'- CTCGACGTGCTAGAGTTTAACC -3'
(R):5'- GATTAGTAGCCACCAGGATTCGTC -3'
Posted On 2013-07-24