Incidental Mutation 'R7874:Btn1a1'
ID608340
Institutional Source Beutler Lab
Gene Symbol Btn1a1
Ensembl Gene ENSMUSG00000000706
Gene Namebutyrophilin, subfamily 1, member A1
SynonymsBtn
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7874 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location23456992-23465901 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23459215 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 355 (T355A)
Ref Sequence ENSEMBL: ENSMUSP00000041013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041674] [ENSMUST00000110434]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041674
AA Change: T355A

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000041013
Gene: ENSMUSG00000000706
AA Change: T355A

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
IGv 46 127 1.97e-11 SMART
IG_like 150 237 9.03e1 SMART
transmembrane domain 246 268 N/A INTRINSIC
PRY 303 355 2.64e-27 SMART
SPRY 356 477 1.46e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110434
SMART Domains Protein: ENSMUSP00000106064
Gene: ENSMUSG00000000706

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
IGv 46 127 1.97e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Butyrophilin is the major protein associated with fat droplets in the milk. It is a member of the immunoglobulin superfamily. It may have a cell surface receptor function. The human butyrophilin gene is localized in the major histocompatibility complex (MHC) class I region of 6p and may have arisen relatively recently in evolution by the shuffling of exons between 2 ancestral gene families [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display impaired lactation and abnormal lipid accumulation in the mammary gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik C A 3: 6,620,141 K84N probably damaging Het
Aacs T C 5: 125,506,207 F276L possibly damaging Het
Aicda T A 6: 122,561,949 I179N probably damaging Het
Anks6 T A 4: 47,049,275 H210L unknown Het
Ano1 G A 7: 144,621,724 R486W probably damaging Het
Atp8b1 A G 18: 64,571,024 V341A probably benign Het
AY761184 C A 8: 21,702,796 R61S possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Ceacam19 A T 7: 19,886,438 D89E probably damaging Het
Cerkl T A 2: 79,338,637 R407S probably damaging Het
Chl1 A G 6: 103,690,263 T389A probably benign Het
Dcn A G 10: 97,510,194 probably null Het
Dhtkd1 T C 2: 5,917,674 Q558R possibly damaging Het
Dhx36 C A 3: 62,488,631 V452L probably benign Het
Dlg5 A G 14: 24,135,619 V1906A probably damaging Het
Emc4 T C 2: 112,363,833 T159A probably damaging Het
Fstl5 C A 3: 76,661,786 P582Q probably benign Het
Gm960 C T 19: 4,658,423 C347Y probably damaging Het
Izumo1r T A 9: 14,900,579 Y171F probably benign Het
Jag2 C T 12: 112,915,946 V401M probably damaging Het
Jph2 C T 2: 163,375,842 G305S probably damaging Het
Kbtbd13 C A 9: 65,390,302 V451L probably benign Het
Map3k12 T C 15: 102,500,642 T813A possibly damaging Het
Mast4 A G 13: 102,739,275 L1295P probably damaging Het
Mia2 T A 12: 59,108,588 D362E probably damaging Het
Mospd3 T C 5: 137,600,028 Y77C probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Mup8 T A 4: 60,222,420 H17L probably damaging Het
Naip2 C T 13: 100,154,951 D1160N not run Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Ndnf A T 6: 65,703,429 M231L probably benign Het
Obscn T G 11: 59,133,276 T523P probably damaging Het
Olfr325 T C 11: 58,581,747 V301A possibly damaging Het
P4htm G T 9: 108,596,949 A130E probably benign Het
Phc3 A T 3: 30,936,714 D439E probably benign Het
Phlpp1 A G 1: 106,389,873 I1275V probably benign Het
Poln A T 5: 34,024,350 I719N probably damaging Het
Ptch2 T A 4: 117,105,964 L216Q possibly damaging Het
Rarres2 T A 6: 48,572,145 K41N probably benign Het
Rasal3 C T 17: 32,396,707 E386K possibly damaging Het
Rev3l T C 10: 39,822,495 I996T possibly damaging Het
Rreb1 A G 13: 37,947,124 N36S probably damaging Het
Serpinb9d T A 13: 33,202,671 probably null Het
Slc14a2 A G 18: 78,160,768 V526A probably benign Het
Slc45a4 T C 15: 73,584,335 probably null Het
Srrm2 G A 17: 23,815,678 R432H unknown Het
Svs1 A G 6: 48,988,666 N536S possibly damaging Het
Th G A 7: 142,895,571 R266* probably null Het
Tln1 T C 4: 43,538,041 Y1853C probably damaging Het
Tln1 A T 4: 43,555,606 D169E probably damaging Het
Tmcc3 G A 10: 94,551,027 probably null Het
Tnxb A G 17: 34,711,443 E2034G probably damaging Het
Ttc4 T C 4: 106,665,684 T346A probably benign Het
Vmn2r5 A T 3: 64,491,032 V842E probably damaging Het
Vmn2r82 T G 10: 79,396,511 N781K probably damaging Het
Zdhhc17 A T 10: 110,982,117 Y67N possibly damaging Het
Zfp273 A G 13: 67,825,439 T229A probably benign Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Zswim8 A G 14: 20,723,149 H1769R probably damaging Het
Zzef1 T C 11: 72,859,653 V929A probably benign Het
Other mutations in Btn1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Btn1a1 APN 13 23461737 missense possibly damaging 0.56
IGL01608:Btn1a1 APN 13 23461608 missense probably benign 0.00
IGL02538:Btn1a1 APN 13 23459215 missense possibly damaging 0.50
IGL02795:Btn1a1 APN 13 23460616 critical splice acceptor site probably null
IGL02933:Btn1a1 APN 13 23460527 missense possibly damaging 0.63
R0063:Btn1a1 UTSW 13 23465097 splice site probably null
R0855:Btn1a1 UTSW 13 23464319 missense probably damaging 1.00
R1754:Btn1a1 UTSW 13 23460468 missense probably benign 0.01
R2122:Btn1a1 UTSW 13 23461521 missense probably damaging 1.00
R3110:Btn1a1 UTSW 13 23461551 missense possibly damaging 0.67
R3112:Btn1a1 UTSW 13 23461551 missense possibly damaging 0.67
R3941:Btn1a1 UTSW 13 23459264 missense probably benign 0.01
R4169:Btn1a1 UTSW 13 23465155 missense probably benign
R4924:Btn1a1 UTSW 13 23464226 splice site probably benign
R4927:Btn1a1 UTSW 13 23460624 splice site probably null
R5255:Btn1a1 UTSW 13 23464154 intron probably benign
R5554:Btn1a1 UTSW 13 23459125 missense possibly damaging 0.55
R5726:Btn1a1 UTSW 13 23459352 missense probably damaging 1.00
R6228:Btn1a1 UTSW 13 23464351 missense probably damaging 0.98
R6664:Btn1a1 UTSW 13 23459320 missense probably benign 0.00
R7117:Btn1a1 UTSW 13 23459245 missense possibly damaging 0.91
R7150:Btn1a1 UTSW 13 23459351 missense probably damaging 1.00
R7151:Btn1a1 UTSW 13 23459313 missense probably damaging 1.00
R7396:Btn1a1 UTSW 13 23461498 missense probably benign 0.01
R7504:Btn1a1 UTSW 13 23461716 missense probably benign 0.10
R7878:Btn1a1 UTSW 13 23459044 missense possibly damaging 0.86
R8271:Btn1a1 UTSW 13 23461749 missense probably benign
R8354:Btn1a1 UTSW 13 23464250 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGTCTCCTGCGTCATAGTCC -3'
(R):5'- AGGCTGATGCAGTCTCTCTTTG -3'

Sequencing Primer
(F):5'- CTGCTAATCGGAGAGAGGTCCTG -3'
(R):5'- TGCCTCCAGTTGACGTGAC -3'
Posted On2019-12-20