Incidental Mutation 'R7874:Map3k12'
ID608349
Institutional Source Beutler Lab
Gene Symbol Map3k12
Ensembl Gene ENSMUSG00000023050
Gene Namemitogen-activated protein kinase kinase kinase 12
SynonymsMUK, DLK, Zpk
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7874 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location102497646-102517064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102500642 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 813 (T813A)
Ref Sequence ENSEMBL: ENSMUSP00000023812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023812] [ENSMUST00000077037] [ENSMUST00000078404] [ENSMUST00000096145] [ENSMUST00000108838] [ENSMUST00000165174] [ENSMUST00000169162] [ENSMUST00000169367] [ENSMUST00000169377] [ENSMUST00000171565] [ENSMUST00000229061] [ENSMUST00000229184] [ENSMUST00000229618] [ENSMUST00000229802] [ENSMUST00000229854] [ENSMUST00000229918] [ENSMUST00000230114] [ENSMUST00000231085]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023812
AA Change: T813A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023812
Gene: ENSMUSG00000023050
AA Change: T813A

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Pfam:Pkinase 158 397 3.3e-59 PFAM
Pfam:Pkinase_Tyr 159 397 2.7e-62 PFAM
coiled coil region 447 501 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 599 617 N/A INTRINSIC
low complexity region 640 663 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
low complexity region 691 727 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077037
SMART Domains Protein: ENSMUSP00000076294
Gene: ENSMUSG00000056851

DomainStartEndE-ValueType
KH 12 80 5.96e-15 SMART
KH 96 167 2.48e-12 SMART
KH 283 353 5.19e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078404
SMART Domains Protein: ENSMUSP00000077509
Gene: ENSMUSG00000056851

DomainStartEndE-ValueType
KH 12 80 5.96e-15 SMART
KH 96 167 2.48e-12 SMART
KH 270 340 5.19e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096145
SMART Domains Protein: ENSMUSP00000093859
Gene: ENSMUSG00000071586

DomainStartEndE-ValueType
low complexity region 29 37 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108838
SMART Domains Protein: ENSMUSP00000104466
Gene: ENSMUSG00000056851

DomainStartEndE-ValueType
KH 12 80 5.96e-15 SMART
KH 96 167 2.48e-12 SMART
KH 252 322 5.19e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165174
Predicted Effect probably benign
Transcript: ENSMUST00000169162
Predicted Effect probably benign
Transcript: ENSMUST00000169367
Predicted Effect possibly damaging
Transcript: ENSMUST00000169377
AA Change: T813A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133209
Gene: ENSMUSG00000023050
AA Change: T813A

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Pfam:Pkinase 159 397 1.2e-58 PFAM
Pfam:Pkinase_Tyr 160 397 3.7e-62 PFAM
coiled coil region 447 501 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 599 617 N/A INTRINSIC
low complexity region 640 663 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
low complexity region 691 727 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171565
AA Change: T813A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127629
Gene: ENSMUSG00000023050
AA Change: T813A

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Pfam:Pkinase 158 397 3.3e-59 PFAM
Pfam:Pkinase_Tyr 159 397 2.7e-62 PFAM
coiled coil region 447 501 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 599 617 N/A INTRINSIC
low complexity region 640 663 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
low complexity region 691 727 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229061
Predicted Effect probably benign
Transcript: ENSMUST00000229184
Predicted Effect probably benign
Transcript: ENSMUST00000229432
Predicted Effect probably benign
Transcript: ENSMUST00000229618
Predicted Effect probably benign
Transcript: ENSMUST00000229802
Predicted Effect probably benign
Transcript: ENSMUST00000229854
Predicted Effect probably benign
Transcript: ENSMUST00000229918
Predicted Effect probably benign
Transcript: ENSMUST00000230114
Predicted Effect probably benign
Transcript: ENSMUST00000231085
Meta Mutation Damage Score 0.0684 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. This kinase contains a leucine-zipper domain and is predominately expressed in neuronal cells. The phosphorylation state of this kinase in synaptic terminals was shown to be regulated by membrane depolarization via calcineurin. This kinase forms heterodimers with leucine zipper containing transcription factors, such as cAMP responsive element binding protein (CREB) and MYC, and thus may play a regulatory role in PKA or retinoic acid induced neuronal differentiation. Alternatively spliced transcript variants encoding different proteins have been described.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a gene-trapped allele lack the brain anterior commissure. Mice homozygous for a knock-out allele exhibit postnatal lethality and abnormal axon growth and radial migration of neocortical pyramidal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik C A 3: 6,620,141 K84N probably damaging Het
Aacs T C 5: 125,506,207 F276L possibly damaging Het
Aicda T A 6: 122,561,949 I179N probably damaging Het
Anks6 T A 4: 47,049,275 H210L unknown Het
Ano1 G A 7: 144,621,724 R486W probably damaging Het
Atp8b1 A G 18: 64,571,024 V341A probably benign Het
AY761184 C A 8: 21,702,796 R61S possibly damaging Het
Btn1a1 T C 13: 23,459,215 T355A possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Ceacam19 A T 7: 19,886,438 D89E probably damaging Het
Cerkl T A 2: 79,338,637 R407S probably damaging Het
Chl1 A G 6: 103,690,263 T389A probably benign Het
Dcn A G 10: 97,510,194 probably null Het
Dhtkd1 T C 2: 5,917,674 Q558R possibly damaging Het
Dhx36 C A 3: 62,488,631 V452L probably benign Het
Dlg5 A G 14: 24,135,619 V1906A probably damaging Het
Emc4 T C 2: 112,363,833 T159A probably damaging Het
Fstl5 C A 3: 76,661,786 P582Q probably benign Het
Gm960 C T 19: 4,658,423 C347Y probably damaging Het
Izumo1r T A 9: 14,900,579 Y171F probably benign Het
Jag2 C T 12: 112,915,946 V401M probably damaging Het
Jph2 C T 2: 163,375,842 G305S probably damaging Het
Kbtbd13 C A 9: 65,390,302 V451L probably benign Het
Mast4 A G 13: 102,739,275 L1295P probably damaging Het
Mia2 T A 12: 59,108,588 D362E probably damaging Het
Mospd3 T C 5: 137,600,028 Y77C probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Mup8 T A 4: 60,222,420 H17L probably damaging Het
Naip2 C T 13: 100,154,951 D1160N not run Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Ndnf A T 6: 65,703,429 M231L probably benign Het
Obscn T G 11: 59,133,276 T523P probably damaging Het
Olfr325 T C 11: 58,581,747 V301A possibly damaging Het
P4htm G T 9: 108,596,949 A130E probably benign Het
Phc3 A T 3: 30,936,714 D439E probably benign Het
Phlpp1 A G 1: 106,389,873 I1275V probably benign Het
Poln A T 5: 34,024,350 I719N probably damaging Het
Ptch2 T A 4: 117,105,964 L216Q possibly damaging Het
Rarres2 T A 6: 48,572,145 K41N probably benign Het
Rasal3 C T 17: 32,396,707 E386K possibly damaging Het
Rev3l T C 10: 39,822,495 I996T possibly damaging Het
Rreb1 A G 13: 37,947,124 N36S probably damaging Het
Serpinb9d T A 13: 33,202,671 probably null Het
Slc14a2 A G 18: 78,160,768 V526A probably benign Het
Slc45a4 T C 15: 73,584,335 probably null Het
Srrm2 G A 17: 23,815,678 R432H unknown Het
Svs1 A G 6: 48,988,666 N536S possibly damaging Het
Th G A 7: 142,895,571 R266* probably null Het
Tln1 T C 4: 43,538,041 Y1853C probably damaging Het
Tln1 A T 4: 43,555,606 D169E probably damaging Het
Tmcc3 G A 10: 94,551,027 probably null Het
Tnxb A G 17: 34,711,443 E2034G probably damaging Het
Ttc4 T C 4: 106,665,684 T346A probably benign Het
Vmn2r5 A T 3: 64,491,032 V842E probably damaging Het
Vmn2r82 T G 10: 79,396,511 N781K probably damaging Het
Zdhhc17 A T 10: 110,982,117 Y67N possibly damaging Het
Zfp273 A G 13: 67,825,439 T229A probably benign Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Zswim8 A G 14: 20,723,149 H1769R probably damaging Het
Zzef1 T C 11: 72,859,653 V929A probably benign Het
Other mutations in Map3k12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Map3k12 APN 15 102503751 missense probably damaging 1.00
IGL01713:Map3k12 APN 15 102502321 missense probably damaging 1.00
IGL01720:Map3k12 APN 15 102502186 unclassified probably benign
IGL02262:Map3k12 APN 15 102502075 missense probably damaging 1.00
IGL02670:Map3k12 APN 15 102503546 missense probably benign 0.09
IGL03004:Map3k12 APN 15 102504196 missense possibly damaging 0.96
IGL03369:Map3k12 APN 15 102502079 missense possibly damaging 0.47
react UTSW 15 102505402 missense probably damaging 1.00
R0894:Map3k12 UTSW 15 102502178 missense probably damaging 1.00
R0918:Map3k12 UTSW 15 102503852 missense probably damaging 0.99
R1547:Map3k12 UTSW 15 102503852 missense probably damaging 1.00
R1844:Map3k12 UTSW 15 102503535 missense probably damaging 1.00
R1880:Map3k12 UTSW 15 102502064 critical splice donor site probably null
R2292:Map3k12 UTSW 15 102500139 missense probably damaging 0.96
R4397:Map3k12 UTSW 15 102501259 missense probably benign 0.44
R4406:Map3k12 UTSW 15 102505402 missense probably damaging 1.00
R4407:Map3k12 UTSW 15 102505402 missense probably damaging 1.00
R4408:Map3k12 UTSW 15 102505402 missense probably damaging 1.00
R4731:Map3k12 UTSW 15 102501282 missense probably benign 0.28
R5074:Map3k12 UTSW 15 102501832 critical splice donor site probably null
R5605:Map3k12 UTSW 15 102503865 missense probably benign 0.17
R5848:Map3k12 UTSW 15 102504235 missense possibly damaging 0.66
R6232:Map3k12 UTSW 15 102503646 missense probably damaging 0.99
R6901:Map3k12 UTSW 15 102500629 missense possibly damaging 0.95
R6901:Map3k12 UTSW 15 102500630 missense possibly damaging 0.65
R6946:Map3k12 UTSW 15 102505134 missense possibly damaging 0.89
R7291:Map3k12 UTSW 15 102502166 missense probably damaging 1.00
R8331:Map3k12 UTSW 15 102502331 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAATGACTGGGTTTCTGATCCC -3'
(R):5'- GGTGCTGTAATGGCATCTTTCAC -3'

Sequencing Primer
(F):5'- GGGTTTCTGATCCCAGTTCAC -3'
(R):5'- ATGGCATCTTTCACTTTGGGAAC -3'
Posted On2019-12-20