Incidental Mutation 'R7875:Hnf4a'
ID608364
Institutional Source Beutler Lab
Gene Symbol Hnf4a
Ensembl Gene ENSMUSG00000017950
Gene Namehepatic nuclear factor 4, alpha
SynonymsHNF-4, HNF4 alpha, Nuclear receptor 2A1, Tcf14, Nr2a1, MODY1, Tcf4, Hnf4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7875 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location163506808-163572910 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 163559060 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 200 (E200*)
Ref Sequence ENSEMBL: ENSMUSP00000018094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018094] [ENSMUST00000109411] [ENSMUST00000137449]
Predicted Effect probably null
Transcript: ENSMUST00000018094
AA Change: E200*
SMART Domains Protein: ENSMUSP00000018094
Gene: ENSMUSG00000017950
AA Change: E200*

DomainStartEndE-ValueType
ZnF_C4 57 128 7.83e-38 SMART
HOLI 189 348 1.12e-47 SMART
low complexity region 383 393 N/A INTRINSIC
low complexity region 426 445 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109411
AA Change: E191*
SMART Domains Protein: ENSMUSP00000105038
Gene: ENSMUSG00000017950
AA Change: E191*

DomainStartEndE-ValueType
ZnF_C4 48 119 7.83e-38 SMART
HOLI 180 339 1.12e-47 SMART
low complexity region 374 384 N/A INTRINSIC
low complexity region 417 436 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000137449
AA Change: E176*
SMART Domains Protein: ENSMUSP00000123511
Gene: ENSMUSG00000017950
AA Change: E176*

DomainStartEndE-ValueType
ZnF_C4 33 104 7.83e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a transcription factor involved in the development of the pancreas, liver, kidney, and intestines. The encoded protein also functions to maintain glucose homeostasis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Nullizygous embryos show delayed growth and lethality, impaired gastrulation, abnormal primitive streak and mesoderm formation, ectoderm apoptosis, and extraembryonic tissue dysplasia. Mice expressing only the alpha1 isoform show glucose intolerance whereas mice expressing alpha7 show dyslipidemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,209,962 I1216V probably benign Het
4932415D10Rik T C 10: 82,287,622 S3185G possibly damaging Het
Acap2 A T 16: 31,139,641 F102I probably damaging Het
Acp7 A T 7: 28,614,727 Y348N probably damaging Het
Adgre4 A T 17: 55,792,016 D174V probably benign Het
Ahdc1 A G 4: 133,063,850 T801A possibly damaging Het
Aldh1a7 A C 19: 20,715,979 V192G possibly damaging Het
Anp32b T G 4: 46,451,301 D2E probably benign Het
Arhgef11 A T 3: 87,684,501 D53V probably damaging Het
Arid5b T C 10: 68,128,941 N300S probably benign Het
Ascc2 A G 11: 4,668,389 N328S probably benign Het
Aspm A T 1: 139,455,134 Q68L probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ccser1 A T 6: 61,311,948 H365L probably benign Het
Col1a2 T A 6: 4,518,500 N213K unknown Het
Col7a1 T C 9: 108,958,695 V681A unknown Het
Dock9 A T 14: 121,625,984 Y792* probably null Het
Fam241b A T 10: 62,134,492 S10R Het
Gab1 C T 8: 80,788,766 D308N probably damaging Het
Gdf11 C T 10: 128,886,341 R215H probably benign Het
Gpc1 T C 1: 92,855,248 probably null Het
Ints2 T C 11: 86,213,062 T1086A probably damaging Het
Kbtbd7 A G 14: 79,427,366 T213A probably benign Het
Kcnt2 A G 1: 140,573,647 D917G probably damaging Het
Kdm5a C A 6: 120,399,018 Y578* probably null Het
Lrrtm4 A T 6: 80,022,360 T252S possibly damaging Het
Mamdc4 C T 2: 25,568,665 W305* probably null Het
Mzb1 A G 18: 35,647,860 I125T possibly damaging Het
Nfrkb A G 9: 31,410,154 T716A possibly damaging Het
Olfr1008 G A 2: 85,689,494 E22K probably benign Het
Olfr1310 A G 2: 112,008,847 V113A probably benign Het
Olfr1368 T A 13: 21,142,923 I45F probably damaging Het
Olfr582 A G 7: 103,041,853 M120V probably damaging Het
Plcxd2 G A 16: 46,009,702 A52V possibly damaging Het
Poteg C T 8: 27,449,914 P95L probably benign Het
Prdm9 A T 17: 15,553,542 Y322* probably null Het
Rab11fip2 G C 19: 59,937,223 I187M possibly damaging Het
Ranbp2 G T 10: 58,478,455 E1666* probably null Het
Rin3 T C 12: 102,369,476 S549P probably damaging Het
Scn10a C T 9: 119,635,442 probably null Het
Scn3a A G 2: 65,497,482 F888S probably damaging Het
Sik3 T A 9: 46,123,230 I96N probably damaging Het
Slc12a7 T A 13: 73,788,604 C128S possibly damaging Het
Syde2 A G 3: 146,020,265 E1304G probably damaging Het
Tagln T C 9: 45,930,382 I199V probably damaging Het
Tarsl2 T A 7: 65,678,151 V536E probably benign Het
Tas2r137 A G 6: 40,492,163 K309R probably damaging Het
Thra A T 11: 98,768,431 D462V probably damaging Het
Topaz1 A G 9: 122,749,587 T521A possibly damaging Het
Uhrf1 A G 17: 56,312,884 N265S possibly damaging Het
Upk3b A T 5: 136,040,203 Y142F probably benign Het
Vmn1r219 T C 13: 23,163,193 V184A possibly damaging Het
Vmn1r58 T C 7: 5,410,754 D159G probably damaging Het
Vnn3 C A 10: 23,867,248 A452D possibly damaging Het
Wscd1 T A 11: 71,788,734 Y478N probably damaging Het
Xrcc5 C T 1: 72,329,931 R315C probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Hnf4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Hnf4a APN 2 163551572 splice site probably benign
IGL02077:Hnf4a APN 2 163562607 critical splice donor site probably null
IGL02419:Hnf4a APN 2 163566282 missense probably damaging 1.00
IGL02931:Hnf4a APN 2 163566117 splice site probably benign
R0230:Hnf4a UTSW 2 163559085 missense probably damaging 1.00
R1670:Hnf4a UTSW 2 163562576 missense probably damaging 1.00
R1743:Hnf4a UTSW 2 163566339 missense possibly damaging 0.65
R2131:Hnf4a UTSW 2 163547418 missense probably benign 0.10
R2509:Hnf4a UTSW 2 163566241 missense probably damaging 1.00
R4209:Hnf4a UTSW 2 163568889 missense probably benign 0.00
R4737:Hnf4a UTSW 2 163564219 missense probably benign 0.05
R5478:Hnf4a UTSW 2 163569006 missense probably benign
R6382:Hnf4a UTSW 2 163569006 missense probably benign
R7016:Hnf4a UTSW 2 163564273 missense probably damaging 1.00
R7443:Hnf4a UTSW 2 163559012 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGAGTTCCTAGGGTATGGGC -3'
(R):5'- AGGTCCCTGTCAACACCTCTAG -3'

Sequencing Primer
(F):5'- ATGGGCTCTCTGTAAGGGAC -3'
(R):5'- AGTTTCCCCACCTGGAAGATG -3'
Posted On2019-12-20