Incidental Mutation 'R0147:Trpm2'
ID 60837
Institutional Source Beutler Lab
Gene Symbol Trpm2
Ensembl Gene ENSMUSG00000009292
Gene Name transient receptor potential cation channel, subfamily M, member 2
Synonyms Trrp7, TRPC7, LTRPC2, 9830168K16Rik
MMRRC Submission 038431-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.169) question?
Stock # R0147 (G1)
Quality Score 208
Status Validated
Chromosome 10
Chromosomal Location 77743556-77805746 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 77761659 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 997 (G997D)
Ref Sequence ENSEMBL: ENSMUSP00000101040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105401]
AlphaFold Q91YD4
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105400
Predicted Effect probably damaging
Transcript: ENSMUST00000105401
AA Change: G997D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: G997D

DomainStartEndE-ValueType
low complexity region 654 672 N/A INTRINSIC
transmembrane domain 750 772 N/A INTRINSIC
Pfam:Ion_trans 794 1057 3.7e-21 PFAM
low complexity region 1078 1090 N/A INTRINSIC
low complexity region 1106 1115 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
PDB:1QVJ|A 1236 1506 3e-37 PDB
SCOP:d1k2ea_ 1369 1502 9e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217806
Meta Mutation Damage Score 0.1647 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 94.5%
  • 20x: 86.1%
Validation Efficiency 67% (88/131)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,639,405 (GRCm39) probably null Het
Abtb2 A G 2: 103,397,480 (GRCm39) I137V probably benign Het
Ank1 T A 8: 23,613,993 (GRCm39) N1545K probably damaging Het
Arl6 T C 16: 59,439,153 (GRCm39) probably benign Het
Avl9 T A 6: 56,713,487 (GRCm39) D248E probably benign Het
Becn1 T C 11: 101,192,562 (GRCm39) E40G probably damaging Het
Bod1l G T 5: 41,976,040 (GRCm39) A1758E possibly damaging Het
Btbd16 C T 7: 130,381,324 (GRCm39) T19I probably damaging Het
Casc3 T A 11: 98,713,325 (GRCm39) N246K possibly damaging Het
Celf1 G T 2: 90,835,035 (GRCm39) probably benign Het
Chrm3 G T 13: 9,928,780 (GRCm39) N85K probably damaging Het
Cluh T A 11: 74,556,764 (GRCm39) Y935N probably damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Col6a5 T C 9: 105,802,993 (GRCm39) D1324G unknown Het
Ctcfl T C 2: 172,960,340 (GRCm39) D81G possibly damaging Het
D630003M21Rik C T 2: 158,044,987 (GRCm39) probably benign Het
Ddx39a C T 8: 84,449,105 (GRCm39) R298C possibly damaging Het
Dnmt3b T G 2: 153,503,377 (GRCm39) N9K possibly damaging Het
Dock8 T C 19: 25,096,823 (GRCm39) L577P probably benign Het
Drc1 A T 5: 30,486,487 (GRCm39) N13I possibly damaging Het
Eml4 T A 17: 83,729,081 (GRCm39) N85K probably damaging Het
Epb41l4a T C 18: 33,931,853 (GRCm39) T581A probably damaging Het
Epha3 T C 16: 63,433,307 (GRCm39) D446G possibly damaging Het
Fam209 G T 2: 172,315,900 (GRCm39) G92C probably damaging Het
Fam98c T A 7: 28,852,146 (GRCm39) R340* probably null Het
Fbxw10 T G 11: 62,738,307 (GRCm39) probably null Het
Galr1 A G 18: 82,423,695 (GRCm39) L194P probably benign Het
Gar1 T C 3: 129,623,122 (GRCm39) H89R probably damaging Het
Gbp4 T A 5: 105,267,362 (GRCm39) Y519F probably benign Het
Gm28042 T A 2: 119,866,944 (GRCm39) S196T probably benign Het
Grid2 T C 6: 64,510,571 (GRCm39) Y734H probably benign Het
Grm6 T A 11: 50,750,144 (GRCm39) I466N possibly damaging Het
Hectd3 T C 4: 116,854,237 (GRCm39) probably benign Het
Hpse2 A C 19: 42,920,099 (GRCm39) probably null Het
Hspb7 T C 4: 141,151,302 (GRCm39) I148T probably damaging Het
Htr1d C A 4: 136,170,788 (GRCm39) T339K probably damaging Het
Ip6k1 T A 9: 107,923,093 (GRCm39) D408E probably damaging Het
Irs2 A T 8: 11,057,568 (GRCm39) M288K probably damaging Het
Kansl3 A T 1: 36,392,897 (GRCm39) C225S probably damaging Het
Knop1 C A 7: 118,445,061 (GRCm39) R301L probably benign Het
Lama5 T C 2: 179,832,199 (GRCm39) H1714R probably benign Het
Mettl14 G A 3: 123,165,043 (GRCm39) T316I probably damaging Het
Mmp15 A T 8: 96,098,945 (GRCm39) N591Y probably benign Het
Mprip T A 11: 59,627,899 (GRCm39) D93E possibly damaging Het
Mtmr14 T A 6: 113,237,627 (GRCm39) probably benign Het
Muc5ac T C 7: 141,364,776 (GRCm39) S1917P probably benign Het
Muc6 C T 7: 141,238,255 (GRCm39) C75Y probably damaging Het
Naip1 A T 13: 100,563,418 (GRCm39) H582Q possibly damaging Het
Nbeal2 G A 9: 110,471,211 (GRCm39) R264* probably null Het
Neb T C 2: 52,139,388 (GRCm39) K140E probably damaging Het
Nfya A G 17: 48,706,026 (GRCm39) V48A possibly damaging Het
Ngf G T 3: 102,417,119 (GRCm39) probably benign Het
Nsmce2 T G 15: 59,250,806 (GRCm39) S26A probably damaging Het
Or52s19 T C 7: 103,007,613 (GRCm39) T263A possibly damaging Het
Or5m13b T A 2: 85,754,362 (GRCm39) I250N possibly damaging Het
Or7e177 T G 9: 20,212,387 (GRCm39) M297R probably damaging Het
Pax1 A G 2: 147,215,654 (GRCm39) S424G probably benign Het
Pcdhb19 A T 18: 37,630,235 (GRCm39) Q10L probably benign Het
Pdcl T C 2: 37,242,142 (GRCm39) I203V probably benign Het
Pknox1 T A 17: 31,823,764 (GRCm39) N379K probably benign Het
Plxna1 C T 6: 89,297,692 (GRCm39) A1831T possibly damaging Het
Prodh T G 16: 17,895,677 (GRCm39) Q360P probably damaging Het
Pygo2 T C 3: 89,340,610 (GRCm39) V299A probably damaging Het
Raf1 C T 6: 115,609,934 (GRCm39) G202S probably benign Het
Rgs11 T A 17: 26,426,433 (GRCm39) probably null Het
Rmc1 C T 18: 12,322,328 (GRCm39) R594C probably damaging Het
Rnf13 A G 3: 57,709,889 (GRCm39) D144G probably damaging Het
Rtel1 T C 2: 180,962,839 (GRCm39) C31R probably damaging Het
Rubcnl T A 14: 75,279,898 (GRCm39) I427K probably damaging Het
Sec23ip C T 7: 128,380,775 (GRCm39) probably benign Het
Slc25a26 T A 6: 94,569,507 (GRCm39) probably null Het
Slc6a7 A G 18: 61,135,183 (GRCm39) probably benign Het
Slco6b1 A T 1: 96,915,562 (GRCm39) noncoding transcript Het
Spata17 A G 1: 186,844,798 (GRCm39) V111A probably damaging Het
Spata22 T A 11: 73,221,979 (GRCm39) M1K probably null Het
Svep1 C T 4: 58,116,608 (GRCm39) D881N possibly damaging Het
Sypl2 T A 3: 108,126,411 (GRCm39) N67I possibly damaging Het
Tasor A G 14: 27,193,725 (GRCm39) D975G probably benign Het
Tenm3 T C 8: 48,689,755 (GRCm39) Y1944C probably damaging Het
Tm9sf4 G T 2: 153,037,233 (GRCm39) V365L probably benign Het
Tmc3 T C 7: 83,256,950 (GRCm39) V401A probably damaging Het
Unc5b A T 10: 60,608,076 (GRCm39) S675T probably damaging Het
Vmn1r217 A G 13: 23,298,107 (GRCm39) M265T probably benign Het
Vps54 T A 11: 21,250,259 (GRCm39) D548E probably benign Het
Wdfy3 A G 5: 102,065,277 (GRCm39) V1297A probably benign Het
Wdr46 T A 17: 34,159,997 (GRCm39) F70I probably benign Het
Zdbf2 C T 1: 63,343,165 (GRCm39) Q515* probably null Het
Zfp710 T A 7: 79,731,721 (GRCm39) C299* probably null Het
Other mutations in Trpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Trpm2 APN 10 77,778,749 (GRCm39) splice site probably null
IGL00773:Trpm2 APN 10 77,785,048 (GRCm39) nonsense probably null
IGL00962:Trpm2 APN 10 77,779,750 (GRCm39) splice site probably benign
IGL01093:Trpm2 APN 10 77,768,114 (GRCm39) missense probably benign 0.04
IGL01124:Trpm2 APN 10 77,781,659 (GRCm39) splice site probably benign
IGL01301:Trpm2 APN 10 77,759,818 (GRCm39) missense probably damaging 1.00
IGL02094:Trpm2 APN 10 77,778,830 (GRCm39) nonsense probably null
IGL02175:Trpm2 APN 10 77,773,741 (GRCm39) missense probably benign 0.07
IGL02653:Trpm2 APN 10 77,748,503 (GRCm39) missense probably benign 0.19
IGL02667:Trpm2 APN 10 77,771,776 (GRCm39) missense probably damaging 1.00
IGL02668:Trpm2 APN 10 77,771,776 (GRCm39) missense probably damaging 1.00
IGL02828:Trpm2 APN 10 77,754,820 (GRCm39) missense probably benign 0.16
IGL02951:Trpm2 APN 10 77,765,112 (GRCm39) missense possibly damaging 0.95
IGL03188:Trpm2 APN 10 77,754,743 (GRCm39) missense probably benign 0.18
IGL03242:Trpm2 APN 10 77,753,568 (GRCm39) missense probably benign
IGL03405:Trpm2 APN 10 77,801,906 (GRCm39) splice site probably benign
Fugit UTSW 10 77,774,202 (GRCm39) missense probably damaging 1.00
scusate UTSW 10 77,802,828 (GRCm39) nonsense probably null
temporal UTSW 10 77,761,516 (GRCm39) missense probably benign 0.30
ANU18:Trpm2 UTSW 10 77,759,818 (GRCm39) missense probably damaging 1.00
R0148:Trpm2 UTSW 10 77,761,659 (GRCm39) missense probably damaging 1.00
R0302:Trpm2 UTSW 10 77,779,824 (GRCm39) splice site probably benign
R0332:Trpm2 UTSW 10 77,783,822 (GRCm39) missense probably damaging 1.00
R0586:Trpm2 UTSW 10 77,759,350 (GRCm39) missense probably damaging 0.99
R0847:Trpm2 UTSW 10 77,765,122 (GRCm39) missense possibly damaging 0.94
R1183:Trpm2 UTSW 10 77,759,398 (GRCm39) missense probably damaging 1.00
R1472:Trpm2 UTSW 10 77,801,841 (GRCm39) missense probably damaging 1.00
R1510:Trpm2 UTSW 10 77,802,828 (GRCm39) nonsense probably null
R1518:Trpm2 UTSW 10 77,778,839 (GRCm39) missense possibly damaging 0.67
R1564:Trpm2 UTSW 10 77,778,833 (GRCm39) missense probably benign 0.14
R1593:Trpm2 UTSW 10 77,778,910 (GRCm39) missense possibly damaging 0.71
R1617:Trpm2 UTSW 10 77,771,709 (GRCm39) splice site probably null
R1673:Trpm2 UTSW 10 77,778,778 (GRCm39) missense probably benign
R1912:Trpm2 UTSW 10 77,781,710 (GRCm39) missense probably benign 0.10
R1932:Trpm2 UTSW 10 77,776,992 (GRCm39) missense probably damaging 1.00
R1993:Trpm2 UTSW 10 77,783,823 (GRCm39) missense probably damaging 1.00
R2013:Trpm2 UTSW 10 77,761,600 (GRCm39) missense probably damaging 1.00
R2151:Trpm2 UTSW 10 77,768,013 (GRCm39) missense probably benign 0.01
R2201:Trpm2 UTSW 10 77,756,305 (GRCm39) nonsense probably null
R2217:Trpm2 UTSW 10 77,777,016 (GRCm39) missense probably damaging 1.00
R2312:Trpm2 UTSW 10 77,754,798 (GRCm39) missense probably benign 0.04
R2339:Trpm2 UTSW 10 77,750,640 (GRCm39) splice site probably benign
R2395:Trpm2 UTSW 10 77,783,714 (GRCm39) missense possibly damaging 0.69
R2396:Trpm2 UTSW 10 77,766,471 (GRCm39) missense probably benign 0.14
R2405:Trpm2 UTSW 10 77,770,558 (GRCm39) missense probably damaging 1.00
R2567:Trpm2 UTSW 10 77,777,008 (GRCm39) missense probably damaging 0.99
R3001:Trpm2 UTSW 10 77,766,368 (GRCm39) critical splice donor site probably null
R3002:Trpm2 UTSW 10 77,766,368 (GRCm39) critical splice donor site probably null
R3125:Trpm2 UTSW 10 77,747,208 (GRCm39) missense probably damaging 1.00
R3500:Trpm2 UTSW 10 77,768,136 (GRCm39) missense probably benign 0.03
R3777:Trpm2 UTSW 10 77,771,824 (GRCm39) missense probably benign 0.13
R3778:Trpm2 UTSW 10 77,771,824 (GRCm39) missense probably benign 0.13
R4272:Trpm2 UTSW 10 77,769,476 (GRCm39) missense probably damaging 1.00
R4384:Trpm2 UTSW 10 77,753,559 (GRCm39) missense probably benign 0.44
R4395:Trpm2 UTSW 10 77,765,053 (GRCm39) missense probably benign 0.01
R4423:Trpm2 UTSW 10 77,770,902 (GRCm39) missense probably benign 0.00
R4452:Trpm2 UTSW 10 77,759,427 (GRCm39) missense probably damaging 1.00
R4612:Trpm2 UTSW 10 77,781,750 (GRCm39) missense probably damaging 0.99
R4662:Trpm2 UTSW 10 77,773,972 (GRCm39) missense probably benign 0.05
R4825:Trpm2 UTSW 10 77,777,007 (GRCm39) missense probably damaging 0.98
R4906:Trpm2 UTSW 10 77,768,023 (GRCm39) nonsense probably null
R4943:Trpm2 UTSW 10 77,801,841 (GRCm39) missense probably damaging 1.00
R4948:Trpm2 UTSW 10 77,753,626 (GRCm39) missense probably benign 0.34
R5046:Trpm2 UTSW 10 77,801,852 (GRCm39) missense probably damaging 1.00
R5320:Trpm2 UTSW 10 77,759,355 (GRCm39) missense probably benign 0.06
R5523:Trpm2 UTSW 10 77,771,795 (GRCm39) missense probably benign 0.04
R5562:Trpm2 UTSW 10 77,795,773 (GRCm39) missense possibly damaging 0.71
R5623:Trpm2 UTSW 10 77,767,973 (GRCm39) missense probably damaging 0.96
R5628:Trpm2 UTSW 10 77,748,470 (GRCm39) missense probably benign 0.00
R5633:Trpm2 UTSW 10 77,774,187 (GRCm39) missense possibly damaging 0.71
R5817:Trpm2 UTSW 10 77,801,814 (GRCm39) missense probably damaging 1.00
R5989:Trpm2 UTSW 10 77,795,734 (GRCm39) missense probably damaging 1.00
R6018:Trpm2 UTSW 10 77,753,547 (GRCm39) missense probably benign 0.00
R6075:Trpm2 UTSW 10 77,770,877 (GRCm39) critical splice donor site probably null
R6092:Trpm2 UTSW 10 77,761,516 (GRCm39) missense probably benign 0.30
R6309:Trpm2 UTSW 10 77,774,202 (GRCm39) missense probably damaging 1.00
R6327:Trpm2 UTSW 10 77,768,061 (GRCm39) missense probably damaging 1.00
R6568:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6579:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6640:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6642:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6798:Trpm2 UTSW 10 77,750,574 (GRCm39) missense probably damaging 0.99
R6999:Trpm2 UTSW 10 77,771,725 (GRCm39) missense probably damaging 1.00
R7034:Trpm2 UTSW 10 77,748,426 (GRCm39) missense probably benign
R7036:Trpm2 UTSW 10 77,748,426 (GRCm39) missense probably benign
R7113:Trpm2 UTSW 10 77,783,765 (GRCm39) missense probably damaging 0.96
R7171:Trpm2 UTSW 10 77,759,848 (GRCm39) missense probably damaging 1.00
R7240:Trpm2 UTSW 10 77,771,710 (GRCm39) critical splice donor site probably null
R7274:Trpm2 UTSW 10 77,759,389 (GRCm39) missense probably benign 0.00
R7379:Trpm2 UTSW 10 77,750,568 (GRCm39) missense probably benign
R7527:Trpm2 UTSW 10 77,801,894 (GRCm39) missense probably benign 0.01
R7571:Trpm2 UTSW 10 77,773,784 (GRCm39) missense probably benign 0.21
R7600:Trpm2 UTSW 10 77,773,885 (GRCm39) missense probably benign 0.02
R7727:Trpm2 UTSW 10 77,761,623 (GRCm39) missense probably benign 0.34
R7771:Trpm2 UTSW 10 77,768,013 (GRCm39) missense probably benign 0.01
R7844:Trpm2 UTSW 10 77,759,340 (GRCm39) missense probably benign 0.00
R8158:Trpm2 UTSW 10 77,783,731 (GRCm39) missense probably damaging 0.99
R8225:Trpm2 UTSW 10 77,783,807 (GRCm39) missense probably damaging 1.00
R8226:Trpm2 UTSW 10 77,783,807 (GRCm39) missense probably damaging 1.00
R8239:Trpm2 UTSW 10 77,771,836 (GRCm39) missense probably benign 0.06
R8275:Trpm2 UTSW 10 77,801,859 (GRCm39) nonsense probably null
R8340:Trpm2 UTSW 10 77,759,458 (GRCm39) nonsense probably null
R8354:Trpm2 UTSW 10 77,769,483 (GRCm39) missense probably damaging 1.00
R8427:Trpm2 UTSW 10 77,747,236 (GRCm39) missense possibly damaging 0.93
R8445:Trpm2 UTSW 10 77,746,086 (GRCm39) missense probably damaging 1.00
R8769:Trpm2 UTSW 10 77,768,128 (GRCm39) missense probably benign 0.00
R9144:Trpm2 UTSW 10 77,765,122 (GRCm39) missense probably benign 0.01
R9286:Trpm2 UTSW 10 77,777,014 (GRCm39) missense probably benign 0.06
R9319:Trpm2 UTSW 10 77,785,032 (GRCm39) missense probably damaging 1.00
R9319:Trpm2 UTSW 10 77,778,776 (GRCm39) nonsense probably null
R9381:Trpm2 UTSW 10 77,747,191 (GRCm39) missense possibly damaging 0.90
R9457:Trpm2 UTSW 10 77,747,226 (GRCm39) missense possibly damaging 0.82
R9477:Trpm2 UTSW 10 77,747,224 (GRCm39) missense probably benign 0.12
R9547:Trpm2 UTSW 10 77,748,467 (GRCm39) missense probably benign 0.33
R9660:Trpm2 UTSW 10 77,766,389 (GRCm39) missense probably benign 0.00
R9663:Trpm2 UTSW 10 77,756,320 (GRCm39) missense probably benign 0.01
Z1177:Trpm2 UTSW 10 77,773,702 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTGACACAGACAGGATGACATGCTG -3'
(R):5'- TTTGGACCCTACCTAGTCAGACACC -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- TACCTAGTCAGACACCCAGCC -3'
Posted On 2013-07-24