Incidental Mutation 'R7875:Acp7'
ID608378
Institutional Source Beutler Lab
Gene Symbol Acp7
Ensembl Gene ENSMUSG00000037469
Gene Nameacid phosphatase 7, tartrate resistant
SynonymsPapl, C330005M16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.388) question?
Stock #R7875 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location28607634-28631332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28614727 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 348 (Y348N)
Ref Sequence ENSEMBL: ENSMUSP00000045437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040112] [ENSMUST00000159418] [ENSMUST00000159560]
Predicted Effect probably damaging
Transcript: ENSMUST00000040112
AA Change: Y348N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045437
Gene: ENSMUSG00000037469
AA Change: Y348N

DomainStartEndE-ValueType
Pfam:Pur_ac_phosph_N 90 183 2.2e-19 PFAM
Pfam:Metallophos 192 395 6.4e-27 PFAM
Pfam:Metallophos_C 420 482 4.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159418
Predicted Effect probably benign
Transcript: ENSMUST00000159560
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purple acid phosphatases (PAPs), including PAPL, are a family of binuclear metallohydrolases that have been identified in plants, animals, and fungi (Flanagan et al., 2006 [PubMed 16793224]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,209,962 I1216V probably benign Het
4932415D10Rik T C 10: 82,287,622 S3185G possibly damaging Het
Acap2 A T 16: 31,139,641 F102I probably damaging Het
Adgre4 A T 17: 55,792,016 D174V probably benign Het
Ahdc1 A G 4: 133,063,850 T801A possibly damaging Het
Aldh1a7 A C 19: 20,715,979 V192G possibly damaging Het
Anp32b T G 4: 46,451,301 D2E probably benign Het
Arhgef11 A T 3: 87,684,501 D53V probably damaging Het
Arid5b T C 10: 68,128,941 N300S probably benign Het
Ascc2 A G 11: 4,668,389 N328S probably benign Het
Aspm A T 1: 139,455,134 Q68L probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ccser1 A T 6: 61,311,948 H365L probably benign Het
Col1a2 T A 6: 4,518,500 N213K unknown Het
Col7a1 T C 9: 108,958,695 V681A unknown Het
Dock9 A T 14: 121,625,984 Y792* probably null Het
Fam241b A T 10: 62,134,492 S10R Het
Gab1 C T 8: 80,788,766 D308N probably damaging Het
Gdf11 C T 10: 128,886,341 R215H probably benign Het
Gpc1 T C 1: 92,855,248 probably null Het
Hnf4a G T 2: 163,559,060 E200* probably null Het
Ints2 T C 11: 86,213,062 T1086A probably damaging Het
Kbtbd7 A G 14: 79,427,366 T213A probably benign Het
Kcnt2 A G 1: 140,573,647 D917G probably damaging Het
Kdm5a C A 6: 120,399,018 Y578* probably null Het
Lrrtm4 A T 6: 80,022,360 T252S possibly damaging Het
Mamdc4 C T 2: 25,568,665 W305* probably null Het
Mzb1 A G 18: 35,647,860 I125T possibly damaging Het
Nfrkb A G 9: 31,410,154 T716A possibly damaging Het
Olfr1008 G A 2: 85,689,494 E22K probably benign Het
Olfr1310 A G 2: 112,008,847 V113A probably benign Het
Olfr1368 T A 13: 21,142,923 I45F probably damaging Het
Olfr582 A G 7: 103,041,853 M120V probably damaging Het
Plcxd2 G A 16: 46,009,702 A52V possibly damaging Het
Poteg C T 8: 27,449,914 P95L probably benign Het
Prdm9 A T 17: 15,553,542 Y322* probably null Het
Rab11fip2 G C 19: 59,937,223 I187M possibly damaging Het
Ranbp2 G T 10: 58,478,455 E1666* probably null Het
Rin3 T C 12: 102,369,476 S549P probably damaging Het
Scn10a C T 9: 119,635,442 probably null Het
Scn3a A G 2: 65,497,482 F888S probably damaging Het
Sik3 T A 9: 46,123,230 I96N probably damaging Het
Slc12a7 T A 13: 73,788,604 C128S possibly damaging Het
Syde2 A G 3: 146,020,265 E1304G probably damaging Het
Tagln T C 9: 45,930,382 I199V probably damaging Het
Tarsl2 T A 7: 65,678,151 V536E probably benign Het
Tas2r137 A G 6: 40,492,163 K309R probably damaging Het
Thra A T 11: 98,768,431 D462V probably damaging Het
Topaz1 A G 9: 122,749,587 T521A possibly damaging Het
Uhrf1 A G 17: 56,312,884 N265S possibly damaging Het
Upk3b A T 5: 136,040,203 Y142F probably benign Het
Vmn1r219 T C 13: 23,163,193 V184A possibly damaging Het
Vmn1r58 T C 7: 5,410,754 D159G probably damaging Het
Vnn3 C A 10: 23,867,248 A452D possibly damaging Het
Wscd1 T A 11: 71,788,734 Y478N probably damaging Het
Xrcc5 C T 1: 72,329,931 R315C probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Acp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Acp7 APN 7 28614697 missense possibly damaging 0.79
IGL00808:Acp7 APN 7 28614952 missense probably damaging 1.00
IGL01085:Acp7 APN 7 28611053 missense probably damaging 1.00
IGL02123:Acp7 APN 7 28629489 missense probably benign
IGL02250:Acp7 APN 7 28629710 splice site probably benign
IGL02255:Acp7 APN 7 28614723 missense probably damaging 1.00
IGL02904:Acp7 APN 7 28608003 missense probably benign 0.11
IGL03110:Acp7 APN 7 28611039 missense probably benign 0.25
R0172:Acp7 UTSW 7 28615124 missense possibly damaging 0.95
R0360:Acp7 UTSW 7 28611128 splice site probably benign
R0364:Acp7 UTSW 7 28611128 splice site probably benign
R1616:Acp7 UTSW 7 28611078 missense probably damaging 1.00
R1973:Acp7 UTSW 7 28607989 missense probably damaging 1.00
R2077:Acp7 UTSW 7 28629482 missense probably damaging 1.00
R2125:Acp7 UTSW 7 28629549 missense probably damaging 0.99
R2256:Acp7 UTSW 7 28614413 missense probably damaging 0.98
R2257:Acp7 UTSW 7 28614413 missense probably damaging 0.98
R2696:Acp7 UTSW 7 28614576 missense probably benign 0.00
R3103:Acp7 UTSW 7 28610984 critical splice donor site probably null
R3753:Acp7 UTSW 7 28616660 missense probably damaging 1.00
R3833:Acp7 UTSW 7 28615094 missense probably benign 0.00
R4622:Acp7 UTSW 7 28614397 missense probably damaging 1.00
R4849:Acp7 UTSW 7 28615452 missense possibly damaging 0.82
R5364:Acp7 UTSW 7 28611023 missense probably benign 0.25
R5382:Acp7 UTSW 7 28615419 missense possibly damaging 0.80
R5665:Acp7 UTSW 7 28616543 missense probably benign 0.31
R5688:Acp7 UTSW 7 28616495 missense probably benign 0.20
R7278:Acp7 UTSW 7 28630882 missense unknown
R7295:Acp7 UTSW 7 28629530 missense possibly damaging 0.83
R7384:Acp7 UTSW 7 28615088 missense possibly damaging 0.89
R8227:Acp7 UTSW 7 28616648 missense probably damaging 1.00
R8772:Acp7 UTSW 7 28616484 missense probably damaging 0.99
RF006:Acp7 UTSW 7 28614779 missense possibly damaging 0.94
X0018:Acp7 UTSW 7 28607981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAGCCCGAACAACTTGCC -3'
(R):5'- GCAAGTCTTCTGATCGCTGAC -3'

Sequencing Primer
(F):5'- CGAACAACTTGCCGTGGAG -3'
(R):5'- CGTCACCTGATTGAGAAGCAGTTC -3'
Posted On2019-12-20