Incidental Mutation 'R7875:Ints2'
ID 608397
Institutional Source Beutler Lab
Gene Symbol Ints2
Ensembl Gene ENSMUSG00000018068
Gene Name integrator complex subunit 2
Synonyms 2810417D08Rik
MMRRC Submission 045927-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7875 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 86101507-86148401 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86103888 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1086 (T1086A)
Ref Sequence ENSEMBL: ENSMUSP00000103674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]
AlphaFold Q80UK8
Predicted Effect probably damaging
Transcript: ENSMUST00000018212
AA Change: T1086A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: T1086A

DomainStartEndE-ValueType
Pfam:INTS2 24 1131 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108039
AA Change: T1086A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: T1086A

DomainStartEndE-ValueType
Pfam:INTS2 24 1132 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128960
Predicted Effect probably benign
Transcript: ENSMUST00000134828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143819
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 A T 16: 30,958,459 (GRCm39) F102I probably damaging Het
Acp7 A T 7: 28,314,152 (GRCm39) Y348N probably damaging Het
Adgre4 A T 17: 56,099,016 (GRCm39) D174V probably benign Het
Ahdc1 A G 4: 132,791,161 (GRCm39) T801A possibly damaging Het
Aldh1a7 A C 19: 20,693,343 (GRCm39) V192G possibly damaging Het
Anp32b T G 4: 46,451,301 (GRCm39) D2E probably benign Het
Arhgef11 A T 3: 87,591,808 (GRCm39) D53V probably damaging Het
Arid5b T C 10: 67,964,771 (GRCm39) N300S probably benign Het
Ascc2 A G 11: 4,618,389 (GRCm39) N328S probably benign Het
Aspm A T 1: 139,382,872 (GRCm39) Q68L probably benign Het
Ccng2 C G 5: 93,421,202 (GRCm39) S237R probably benign Het
Ccser1 A T 6: 61,288,932 (GRCm39) H365L probably benign Het
Col1a2 T A 6: 4,518,500 (GRCm39) N213K unknown Het
Col7a1 T C 9: 108,787,763 (GRCm39) V681A unknown Het
Cplane1 A G 15: 8,239,446 (GRCm39) I1216V probably benign Het
Dock9 A T 14: 121,863,396 (GRCm39) Y792* probably null Het
Fam241b A T 10: 61,970,271 (GRCm39) S10R Het
Gab1 C T 8: 81,515,395 (GRCm39) D308N probably damaging Het
Gdf11 C T 10: 128,722,210 (GRCm39) R215H probably benign Het
Gpc1 T C 1: 92,782,970 (GRCm39) probably null Het
Hnf4a G T 2: 163,400,980 (GRCm39) E200* probably null Het
Kbtbd7 A G 14: 79,664,806 (GRCm39) T213A probably benign Het
Kcnt2 A G 1: 140,501,385 (GRCm39) D917G probably damaging Het
Kdm5a C A 6: 120,375,979 (GRCm39) Y578* probably null Het
Lrrtm4 A T 6: 79,999,343 (GRCm39) T252S possibly damaging Het
Mamdc4 C T 2: 25,458,677 (GRCm39) W305* probably null Het
Mzb1 A G 18: 35,780,913 (GRCm39) I125T possibly damaging Het
Nfrkb A G 9: 31,321,450 (GRCm39) T716A possibly damaging Het
Or2ad1 T A 13: 21,327,093 (GRCm39) I45F probably damaging Het
Or4f6 A G 2: 111,839,192 (GRCm39) V113A probably benign Het
Or52r1b A G 7: 102,691,060 (GRCm39) M120V probably damaging Het
Or8k16 G A 2: 85,519,838 (GRCm39) E22K probably benign Het
Plcxd2 G A 16: 45,830,065 (GRCm39) A52V possibly damaging Het
Poteg C T 8: 27,939,942 (GRCm39) P95L probably benign Het
Prdm9 A T 17: 15,773,804 (GRCm39) Y322* probably null Het
Rab11fip2 G C 19: 59,925,655 (GRCm39) I187M possibly damaging Het
Ranbp2 G T 10: 58,314,277 (GRCm39) E1666* probably null Het
Rin3 T C 12: 102,335,735 (GRCm39) S549P probably damaging Het
Scn10a C T 9: 119,464,508 (GRCm39) probably null Het
Scn3a A G 2: 65,327,826 (GRCm39) F888S probably damaging Het
Sik3 T A 9: 46,034,528 (GRCm39) I96N probably damaging Het
Slc12a7 T A 13: 73,936,723 (GRCm39) C128S possibly damaging Het
Spata31h1 T C 10: 82,123,456 (GRCm39) S3185G possibly damaging Het
Syde2 A G 3: 145,726,020 (GRCm39) E1304G probably damaging Het
Tagln T C 9: 45,841,680 (GRCm39) I199V probably damaging Het
Tars3 T A 7: 65,327,899 (GRCm39) V536E probably benign Het
Tas2r140 A G 6: 40,469,097 (GRCm39) K309R probably damaging Het
Thra A T 11: 98,659,257 (GRCm39) D462V probably damaging Het
Topaz1 A G 9: 122,578,652 (GRCm39) T521A possibly damaging Het
Uhrf1 A G 17: 56,619,884 (GRCm39) N265S possibly damaging Het
Upk3b A T 5: 136,069,057 (GRCm39) Y142F probably benign Het
Vmn1r219 T C 13: 23,347,363 (GRCm39) V184A possibly damaging Het
Vmn1r58 T C 7: 5,413,753 (GRCm39) D159G probably damaging Het
Vnn3 C A 10: 23,743,146 (GRCm39) A452D possibly damaging Het
Wscd1 T A 11: 71,679,560 (GRCm39) Y478N probably damaging Het
Xrcc5 C T 1: 72,369,090 (GRCm39) R315C probably damaging Het
Zkscan5 A C 5: 145,157,676 (GRCm39) H726P probably damaging Het
Other mutations in Ints2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ints2 APN 11 86,123,961 (GRCm39) missense probably damaging 1.00
IGL02490:Ints2 APN 11 86,124,009 (GRCm39) missense possibly damaging 0.93
IGL02612:Ints2 APN 11 86,106,404 (GRCm39) missense probably damaging 1.00
IGL03396:Ints2 APN 11 86,103,888 (GRCm39) missense probably damaging 0.99
R0015:Ints2 UTSW 11 86,140,113 (GRCm39) missense probably damaging 1.00
R0015:Ints2 UTSW 11 86,140,113 (GRCm39) missense probably damaging 1.00
R0355:Ints2 UTSW 11 86,125,575 (GRCm39) missense probably benign 0.00
R0389:Ints2 UTSW 11 86,139,677 (GRCm39) missense probably damaging 1.00
R0631:Ints2 UTSW 11 86,124,022 (GRCm39) missense probably benign 0.02
R0944:Ints2 UTSW 11 86,135,289 (GRCm39) missense possibly damaging 0.85
R1268:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1269:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1270:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1396:Ints2 UTSW 11 86,140,074 (GRCm39) missense probably damaging 0.98
R1474:Ints2 UTSW 11 86,117,607 (GRCm39) missense probably damaging 0.97
R1503:Ints2 UTSW 11 86,117,607 (GRCm39) missense probably damaging 0.97
R1840:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1987:Ints2 UTSW 11 86,108,626 (GRCm39) missense probably benign 0.03
R1990:Ints2 UTSW 11 86,139,760 (GRCm39) missense possibly damaging 0.58
R1991:Ints2 UTSW 11 86,139,760 (GRCm39) missense possibly damaging 0.58
R3694:Ints2 UTSW 11 86,133,827 (GRCm39) missense probably benign 0.41
R4056:Ints2 UTSW 11 86,133,778 (GRCm39) missense probably damaging 1.00
R4057:Ints2 UTSW 11 86,133,778 (GRCm39) missense probably damaging 1.00
R4569:Ints2 UTSW 11 86,147,024 (GRCm39) missense probably damaging 1.00
R4585:Ints2 UTSW 11 86,140,101 (GRCm39) missense probably damaging 1.00
R4586:Ints2 UTSW 11 86,140,101 (GRCm39) missense probably damaging 1.00
R4806:Ints2 UTSW 11 86,147,035 (GRCm39) missense probably benign 0.10
R4929:Ints2 UTSW 11 86,103,479 (GRCm39) missense possibly damaging 0.56
R5031:Ints2 UTSW 11 86,147,026 (GRCm39) missense probably damaging 1.00
R5064:Ints2 UTSW 11 86,140,100 (GRCm39) missense probably damaging 1.00
R5270:Ints2 UTSW 11 86,106,621 (GRCm39) missense probably damaging 1.00
R5621:Ints2 UTSW 11 86,133,773 (GRCm39) missense probably benign 0.32
R5875:Ints2 UTSW 11 86,129,138 (GRCm39) missense probably benign 0.04
R5908:Ints2 UTSW 11 86,106,371 (GRCm39) critical splice donor site probably null
R5914:Ints2 UTSW 11 86,113,000 (GRCm39) missense probably benign 0.03
R5941:Ints2 UTSW 11 86,141,798 (GRCm39) missense probably benign 0.01
R5975:Ints2 UTSW 11 86,117,574 (GRCm39) missense possibly damaging 0.72
R6003:Ints2 UTSW 11 86,129,294 (GRCm39) missense probably damaging 1.00
R6091:Ints2 UTSW 11 86,127,429 (GRCm39) missense probably damaging 0.96
R6209:Ints2 UTSW 11 86,115,884 (GRCm39) missense probably damaging 1.00
R6567:Ints2 UTSW 11 86,117,487 (GRCm39) missense probably benign 0.42
R6764:Ints2 UTSW 11 86,103,605 (GRCm39) missense probably benign 0.00
R7033:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R7132:Ints2 UTSW 11 86,108,580 (GRCm39) missense probably benign 0.26
R7337:Ints2 UTSW 11 86,108,668 (GRCm39) missense probably benign 0.00
R7410:Ints2 UTSW 11 86,124,052 (GRCm39) missense probably benign 0.02
R7483:Ints2 UTSW 11 86,106,444 (GRCm39) missense probably damaging 1.00
R7503:Ints2 UTSW 11 86,122,881 (GRCm39) missense probably benign
R7804:Ints2 UTSW 11 86,103,489 (GRCm39) missense possibly damaging 0.92
R7845:Ints2 UTSW 11 86,129,089 (GRCm39) missense possibly damaging 0.93
R7918:Ints2 UTSW 11 86,113,043 (GRCm39) missense probably damaging 1.00
R7922:Ints2 UTSW 11 86,135,453 (GRCm39) missense probably benign 0.29
R8058:Ints2 UTSW 11 86,146,179 (GRCm39) missense probably benign 0.05
R8134:Ints2 UTSW 11 86,103,486 (GRCm39) missense probably damaging 1.00
R8189:Ints2 UTSW 11 86,106,396 (GRCm39) missense probably damaging 1.00
R8295:Ints2 UTSW 11 86,115,914 (GRCm39) missense probably damaging 0.97
R8348:Ints2 UTSW 11 86,146,249 (GRCm39) missense probably benign
R8448:Ints2 UTSW 11 86,146,249 (GRCm39) missense probably benign
R8784:Ints2 UTSW 11 86,115,941 (GRCm39) nonsense probably null
R8784:Ints2 UTSW 11 86,112,963 (GRCm39) missense probably damaging 1.00
R8942:Ints2 UTSW 11 86,103,720 (GRCm39) missense probably benign 0.00
R9037:Ints2 UTSW 11 86,106,530 (GRCm39) missense probably benign
R9154:Ints2 UTSW 11 86,125,524 (GRCm39) missense probably damaging 1.00
R9397:Ints2 UTSW 11 86,135,311 (GRCm39) missense probably benign 0.01
R9412:Ints2 UTSW 11 86,117,589 (GRCm39) missense probably damaging 0.99
R9472:Ints2 UTSW 11 86,133,824 (GRCm39) missense
R9476:Ints2 UTSW 11 86,135,335 (GRCm39) missense probably benign
R9510:Ints2 UTSW 11 86,135,335 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GAAGTAGCACTTACGTGTAATGATTGG -3'
(R):5'- GGACAGCATCCTATAAAACTTCGTC -3'

Sequencing Primer
(F):5'- CGTGTAATGATTGGATCAATGTCTC -3'
(R):5'- GGATGCCTGTGTTGAATTTA -3'
Posted On 2019-12-20