Mutagenetix > Incidental Mutation

Incidental Mutation 'R7875:Ints2'

608397

Institutional Source

Beutler Lab

Gene Symbol

Ints2

Ensembl Gene

ENSMUSG00000018068

Gene Name

integrator complex subunit 2

Synonyms

2810417D08Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7875 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

86210681-86257575 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86213062 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1086 (T1086A)

Ref Sequence

ENSEMBL: ENSMUSP00000103674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]

AlphaFold

Q80UK8

Predicted Effect

probably damaging
Transcript: ENSMUST00000018212
AA Change: T1086A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: T1086A

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1131	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000108039
AA Change: T1086A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: T1086A

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1132	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128960

Predicted Effect

probably benign
Transcript: ENSMUST00000134828

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143819

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	A	G	15: 8,209,962	I1216V	probably benign	Het
4932415D10Rik	T	C	10: 82,287,622	S3185G	possibly damaging	Het
Acap2	A	T	16: 31,139,641	F102I	probably damaging	Het
Acp7	A	T	7: 28,614,727	Y348N	probably damaging	Het
Adgre4	A	T	17: 55,792,016	D174V	probably benign	Het
Ahdc1	A	G	4: 133,063,850	T801A	possibly damaging	Het
Aldh1a7	A	C	19: 20,715,979	V192G	possibly damaging	Het
Anp32b	T	G	4: 46,451,301	D2E	probably benign	Het
Arhgef11	A	T	3: 87,684,501	D53V	probably damaging	Het
Arid5b	T	C	10: 68,128,941	N300S	probably benign	Het
Ascc2	A	G	11: 4,668,389	N328S	probably benign	Het
Aspm	A	T	1: 139,455,134	Q68L	probably benign	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Ccser1	A	T	6: 61,311,948	H365L	probably benign	Het
Col1a2	T	A	6: 4,518,500	N213K	unknown	Het
Col7a1	T	C	9: 108,958,695	V681A	unknown	Het
Dock9	A	T	14: 121,625,984	Y792*	probably null	Het
Fam241b	A	T	10: 62,134,492	S10R		Het
Gab1	C	T	8: 80,788,766	D308N	probably damaging	Het
Gdf11	C	T	10: 128,886,341	R215H	probably benign	Het
Gpc1	T	C	1: 92,855,248		probably null	Het
Hnf4a	G	T	2: 163,559,060	E200*	probably null	Het
Kbtbd7	A	G	14: 79,427,366	T213A	probably benign	Het
Kcnt2	A	G	1: 140,573,647	D917G	probably damaging	Het
Kdm5a	C	A	6: 120,399,018	Y578*	probably null	Het
Lrrtm4	A	T	6: 80,022,360	T252S	possibly damaging	Het
Mamdc4	C	T	2: 25,568,665	W305*	probably null	Het
Mzb1	A	G	18: 35,647,860	I125T	possibly damaging	Het
Nfrkb	A	G	9: 31,410,154	T716A	possibly damaging	Het
Olfr1008	G	A	2: 85,689,494	E22K	probably benign	Het
Olfr1310	A	G	2: 112,008,847	V113A	probably benign	Het
Olfr1368	T	A	13: 21,142,923	I45F	probably damaging	Het
Olfr582	A	G	7: 103,041,853	M120V	probably damaging	Het
Plcxd2	G	A	16: 46,009,702	A52V	possibly damaging	Het
Poteg	C	T	8: 27,449,914	P95L	probably benign	Het
Prdm9	A	T	17: 15,553,542	Y322*	probably null	Het
Rab11fip2	G	C	19: 59,937,223	I187M	possibly damaging	Het
Ranbp2	G	T	10: 58,478,455	E1666*	probably null	Het
Rin3	T	C	12: 102,369,476	S549P	probably damaging	Het
Scn10a	C	T	9: 119,635,442		probably null	Het
Scn3a	A	G	2: 65,497,482	F888S	probably damaging	Het
Sik3	T	A	9: 46,123,230	I96N	probably damaging	Het
Slc12a7	T	A	13: 73,788,604	C128S	possibly damaging	Het
Syde2	A	G	3: 146,020,265	E1304G	probably damaging	Het
Tagln	T	C	9: 45,930,382	I199V	probably damaging	Het
Tarsl2	T	A	7: 65,678,151	V536E	probably benign	Het
Tas2r137	A	G	6: 40,492,163	K309R	probably damaging	Het
Thra	A	T	11: 98,768,431	D462V	probably damaging	Het
Topaz1	A	G	9: 122,749,587	T521A	possibly damaging	Het
Uhrf1	A	G	17: 56,312,884	N265S	possibly damaging	Het
Upk3b	A	T	5: 136,040,203	Y142F	probably benign	Het
Vmn1r219	T	C	13: 23,163,193	V184A	possibly damaging	Het
Vmn1r58	T	C	7: 5,410,754	D159G	probably damaging	Het
Vnn3	C	A	10: 23,867,248	A452D	possibly damaging	Het
Wscd1	T	A	11: 71,788,734	Y478N	probably damaging	Het
Xrcc5	C	T	1: 72,329,931	R315C	probably damaging	Het
Zkscan5	A	C	5: 145,220,866	H726P	probably damaging	Het

Other mutations in Ints2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Ints2	APN	11	86233135	missense	probably damaging	1.00
IGL02490:Ints2	APN	11	86233183	missense	possibly damaging	0.93
IGL02612:Ints2	APN	11	86215578	missense	probably damaging	1.00
IGL03396:Ints2	APN	11	86213062	missense	probably damaging	0.99
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0355:Ints2	UTSW	11	86234749	missense	probably benign	0.00
R0389:Ints2	UTSW	11	86248851	missense	probably damaging	1.00
R0631:Ints2	UTSW	11	86233196	missense	probably benign	0.02
R0944:Ints2	UTSW	11	86244463	missense	possibly damaging	0.85
R1268:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1269:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1270:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1396:Ints2	UTSW	11	86249248	missense	probably damaging	0.98
R1474:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1503:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1840:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1987:Ints2	UTSW	11	86217800	missense	probably benign	0.03
R1990:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R1991:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R3694:Ints2	UTSW	11	86243001	missense	probably benign	0.41
R4056:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4057:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4569:Ints2	UTSW	11	86256198	missense	probably damaging	1.00
R4585:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4586:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4806:Ints2	UTSW	11	86256209	missense	probably benign	0.10
R4929:Ints2	UTSW	11	86212653	missense	possibly damaging	0.56
R5031:Ints2	UTSW	11	86256200	missense	probably damaging	1.00
R5064:Ints2	UTSW	11	86249274	missense	probably damaging	1.00
R5270:Ints2	UTSW	11	86215795	missense	probably damaging	1.00
R5621:Ints2	UTSW	11	86242947	missense	probably benign	0.32
R5875:Ints2	UTSW	11	86238312	missense	probably benign	0.04
R5908:Ints2	UTSW	11	86215545	critical splice donor site	probably null
R5914:Ints2	UTSW	11	86222174	missense	probably benign	0.03
R5941:Ints2	UTSW	11	86250972	missense	probably benign	0.01
R5975:Ints2	UTSW	11	86226748	missense	possibly damaging	0.72
R6003:Ints2	UTSW	11	86238468	missense	probably damaging	1.00
R6091:Ints2	UTSW	11	86236603	missense	probably damaging	0.96
R6209:Ints2	UTSW	11	86225058	missense	probably damaging	1.00
R6567:Ints2	UTSW	11	86226661	missense	probably benign	0.42
R6764:Ints2	UTSW	11	86212779	missense	probably benign	0.00
R7033:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R7132:Ints2	UTSW	11	86217754	missense	probably benign	0.26
R7337:Ints2	UTSW	11	86217842	missense	probably benign	0.00
R7410:Ints2	UTSW	11	86233226	missense	probably benign	0.02
R7483:Ints2	UTSW	11	86215618	missense	probably damaging	1.00
R7503:Ints2	UTSW	11	86232055	missense	probably benign
R7804:Ints2	UTSW	11	86212663	missense	possibly damaging	0.92
R7845:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7918:Ints2	UTSW	11	86222217	missense	probably damaging	1.00
R7922:Ints2	UTSW	11	86244627	missense	probably benign	0.29
R8058:Ints2	UTSW	11	86255353	missense	probably benign	0.05
R8134:Ints2	UTSW	11	86212660	missense	probably damaging	1.00
R8189:Ints2	UTSW	11	86215570	missense	probably damaging	1.00
R8295:Ints2	UTSW	11	86225088	missense	probably damaging	0.97
R8348:Ints2	UTSW	11	86255423	missense	probably benign
R8448:Ints2	UTSW	11	86255423	missense	probably benign
R8784:Ints2	UTSW	11	86222137	missense	probably damaging	1.00
R8784:Ints2	UTSW	11	86225115	nonsense	probably null
R8942:Ints2	UTSW	11	86212894	missense	probably benign	0.00
R9037:Ints2	UTSW	11	86215704	missense	probably benign
R9154:Ints2	UTSW	11	86234698	missense	probably damaging	1.00
R9397:Ints2	UTSW	11	86244485	missense	probably benign	0.01
R9412:Ints2	UTSW	11	86226763	missense	probably damaging	0.99
R9472:Ints2	UTSW	11	86242998	missense
R9476:Ints2	UTSW	11	86244509	missense	probably benign
R9510:Ints2	UTSW	11	86244509	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GAAGTAGCACTTACGTGTAATGATTGG -3'
(R):5'- GGACAGCATCCTATAAAACTTCGTC -3'

Sequencing Primer
(F):5'- CGTGTAATGATTGGATCAATGTCTC -3'
(R):5'- GGATGCCTGTGTTGAATTTA -3'

Posted On

2019-12-20