Incidental Mutation 'R7875:Olfr1368'
ID608400
Institutional Source Beutler Lab
Gene Symbol Olfr1368
Ensembl Gene ENSMUSG00000045474
Gene Nameolfactory receptor 1368
SynonymsMOR256-15, GA_x6K02T2QHY8-12104556-12105500
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R7875 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location21141882-21145867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21142923 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 45 (I45F)
Ref Sequence ENSEMBL: ENSMUSP00000149549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055298] [ENSMUST00000216039]
Predicted Effect probably damaging
Transcript: ENSMUST00000055298
AA Change: I45F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050942
Gene: ENSMUSG00000045474
AA Change: I45F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.8e-49 PFAM
Pfam:7tm_1 41 290 1.6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216039
AA Change: I45F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,209,962 I1216V probably benign Het
4932415D10Rik T C 10: 82,287,622 S3185G possibly damaging Het
Acap2 A T 16: 31,139,641 F102I probably damaging Het
Acp7 A T 7: 28,614,727 Y348N probably damaging Het
Adgre4 A T 17: 55,792,016 D174V probably benign Het
Ahdc1 A G 4: 133,063,850 T801A possibly damaging Het
Aldh1a7 A C 19: 20,715,979 V192G possibly damaging Het
Anp32b T G 4: 46,451,301 D2E probably benign Het
Arhgef11 A T 3: 87,684,501 D53V probably damaging Het
Arid5b T C 10: 68,128,941 N300S probably benign Het
Ascc2 A G 11: 4,668,389 N328S probably benign Het
Aspm A T 1: 139,455,134 Q68L probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ccser1 A T 6: 61,311,948 H365L probably benign Het
Col1a2 T A 6: 4,518,500 N213K unknown Het
Col7a1 T C 9: 108,958,695 V681A unknown Het
Dock9 A T 14: 121,625,984 Y792* probably null Het
Fam241b A T 10: 62,134,492 S10R Het
Gab1 C T 8: 80,788,766 D308N probably damaging Het
Gdf11 C T 10: 128,886,341 R215H probably benign Het
Gpc1 T C 1: 92,855,248 probably null Het
Hnf4a G T 2: 163,559,060 E200* probably null Het
Ints2 T C 11: 86,213,062 T1086A probably damaging Het
Kbtbd7 A G 14: 79,427,366 T213A probably benign Het
Kcnt2 A G 1: 140,573,647 D917G probably damaging Het
Kdm5a C A 6: 120,399,018 Y578* probably null Het
Lrrtm4 A T 6: 80,022,360 T252S possibly damaging Het
Mamdc4 C T 2: 25,568,665 W305* probably null Het
Mzb1 A G 18: 35,647,860 I125T possibly damaging Het
Nfrkb A G 9: 31,410,154 T716A possibly damaging Het
Olfr1008 G A 2: 85,689,494 E22K probably benign Het
Olfr1310 A G 2: 112,008,847 V113A probably benign Het
Olfr582 A G 7: 103,041,853 M120V probably damaging Het
Plcxd2 G A 16: 46,009,702 A52V possibly damaging Het
Poteg C T 8: 27,449,914 P95L probably benign Het
Prdm9 A T 17: 15,553,542 Y322* probably null Het
Rab11fip2 G C 19: 59,937,223 I187M possibly damaging Het
Ranbp2 G T 10: 58,478,455 E1666* probably null Het
Rin3 T C 12: 102,369,476 S549P probably damaging Het
Scn10a C T 9: 119,635,442 probably null Het
Scn3a A G 2: 65,497,482 F888S probably damaging Het
Sik3 T A 9: 46,123,230 I96N probably damaging Het
Slc12a7 T A 13: 73,788,604 C128S possibly damaging Het
Syde2 A G 3: 146,020,265 E1304G probably damaging Het
Tagln T C 9: 45,930,382 I199V probably damaging Het
Tarsl2 T A 7: 65,678,151 V536E probably benign Het
Tas2r137 A G 6: 40,492,163 K309R probably damaging Het
Thra A T 11: 98,768,431 D462V probably damaging Het
Topaz1 A G 9: 122,749,587 T521A possibly damaging Het
Uhrf1 A G 17: 56,312,884 N265S possibly damaging Het
Upk3b A T 5: 136,040,203 Y142F probably benign Het
Vmn1r219 T C 13: 23,163,193 V184A possibly damaging Het
Vmn1r58 T C 7: 5,410,754 D159G probably damaging Het
Vnn3 C A 10: 23,867,248 A452D possibly damaging Het
Wscd1 T A 11: 71,788,734 Y478N probably damaging Het
Xrcc5 C T 1: 72,329,931 R315C probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Olfr1368
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03354:Olfr1368 APN 13 21142484 missense probably damaging 1.00
IGL03385:Olfr1368 APN 13 21142487 missense probably benign 0.01
R0137:Olfr1368 UTSW 13 21142166 missense possibly damaging 0.86
R1168:Olfr1368 UTSW 13 21142617 missense probably benign 0.04
R1212:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1214:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1237:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1238:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1239:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1280:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1309:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1436:Olfr1368 UTSW 13 21142992 missense probably benign 0.01
R1443:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1444:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1602:Olfr1368 UTSW 13 21142650 missense probably damaging 0.99
R1627:Olfr1368 UTSW 13 21142955 missense probably damaging 0.99
R1649:Olfr1368 UTSW 13 21142742 missense probably damaging 1.00
R1781:Olfr1368 UTSW 13 21142764 missense probably benign 0.08
R1858:Olfr1368 UTSW 13 21142394 missense probably damaging 1.00
R2520:Olfr1368 UTSW 13 21142576 nonsense probably null
R4873:Olfr1368 UTSW 13 21142280 missense probably damaging 1.00
R4875:Olfr1368 UTSW 13 21142280 missense probably damaging 1.00
R5009:Olfr1368 UTSW 13 21142265 missense probably benign 0.01
R6222:Olfr1368 UTSW 13 21142877 missense probably damaging 1.00
R7031:Olfr1368 UTSW 13 21143000 missense probably benign
R7126:Olfr1368 UTSW 13 21142718 missense probably damaging 1.00
R7691:Olfr1368 UTSW 13 21142970 missense probably benign
R8015:Olfr1368 UTSW 13 21142133 missense probably benign
R8155:Olfr1368 UTSW 13 21142892 missense probably damaging 1.00
R8247:Olfr1368 UTSW 13 21142125 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAAGAGGAGACATTCTGTGG -3'
(R):5'- TACAGAGACTTTCCATTCCATACC -3'

Sequencing Primer
(F):5'- AGACATTCTGTGGCTCCCAG -3'
(R):5'- AGCTCTGAGACAGACTTC -3'
Posted On2019-12-20