Incidental Mutation 'R7875:Dock9'
ID 608404
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Name dedicator of cytokinesis 9
Synonyms D14Wsu89e, Zizimin1, B230309H04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7875 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 121542046-121797837 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 121625984 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 792 (Y792*)
Ref Sequence ENSEMBL: ENSMUSP00000148834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000040700
AA Change: Y792*
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: Y792*

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000100299
AA Change: Y794*
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: Y794*

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000212181
AA Change: Y792*
Predicted Effect probably null
Transcript: ENSMUST00000212376
AA Change: Y806*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,209,962 I1216V probably benign Het
4932415D10Rik T C 10: 82,287,622 S3185G possibly damaging Het
Acap2 A T 16: 31,139,641 F102I probably damaging Het
Acp7 A T 7: 28,614,727 Y348N probably damaging Het
Adgre4 A T 17: 55,792,016 D174V probably benign Het
Ahdc1 A G 4: 133,063,850 T801A possibly damaging Het
Aldh1a7 A C 19: 20,715,979 V192G possibly damaging Het
Anp32b T G 4: 46,451,301 D2E probably benign Het
Arhgef11 A T 3: 87,684,501 D53V probably damaging Het
Arid5b T C 10: 68,128,941 N300S probably benign Het
Ascc2 A G 11: 4,668,389 N328S probably benign Het
Aspm A T 1: 139,455,134 Q68L probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ccser1 A T 6: 61,311,948 H365L probably benign Het
Col1a2 T A 6: 4,518,500 N213K unknown Het
Col7a1 T C 9: 108,958,695 V681A unknown Het
Fam241b A T 10: 62,134,492 S10R Het
Gab1 C T 8: 80,788,766 D308N probably damaging Het
Gdf11 C T 10: 128,886,341 R215H probably benign Het
Gpc1 T C 1: 92,855,248 probably null Het
Hnf4a G T 2: 163,559,060 E200* probably null Het
Ints2 T C 11: 86,213,062 T1086A probably damaging Het
Kbtbd7 A G 14: 79,427,366 T213A probably benign Het
Kcnt2 A G 1: 140,573,647 D917G probably damaging Het
Kdm5a C A 6: 120,399,018 Y578* probably null Het
Lrrtm4 A T 6: 80,022,360 T252S possibly damaging Het
Mamdc4 C T 2: 25,568,665 W305* probably null Het
Mzb1 A G 18: 35,647,860 I125T possibly damaging Het
Nfrkb A G 9: 31,410,154 T716A possibly damaging Het
Olfr1008 G A 2: 85,689,494 E22K probably benign Het
Olfr1310 A G 2: 112,008,847 V113A probably benign Het
Olfr1368 T A 13: 21,142,923 I45F probably damaging Het
Olfr582 A G 7: 103,041,853 M120V probably damaging Het
Plcxd2 G A 16: 46,009,702 A52V possibly damaging Het
Poteg C T 8: 27,449,914 P95L probably benign Het
Prdm9 A T 17: 15,553,542 Y322* probably null Het
Rab11fip2 G C 19: 59,937,223 I187M possibly damaging Het
Ranbp2 G T 10: 58,478,455 E1666* probably null Het
Rin3 T C 12: 102,369,476 S549P probably damaging Het
Scn10a C T 9: 119,635,442 probably null Het
Scn3a A G 2: 65,497,482 F888S probably damaging Het
Sik3 T A 9: 46,123,230 I96N probably damaging Het
Slc12a7 T A 13: 73,788,604 C128S possibly damaging Het
Syde2 A G 3: 146,020,265 E1304G probably damaging Het
Tagln T C 9: 45,930,382 I199V probably damaging Het
Tarsl2 T A 7: 65,678,151 V536E probably benign Het
Tas2r137 A G 6: 40,492,163 K309R probably damaging Het
Thra A T 11: 98,768,431 D462V probably damaging Het
Topaz1 A G 9: 122,749,587 T521A possibly damaging Het
Uhrf1 A G 17: 56,312,884 N265S possibly damaging Het
Upk3b A T 5: 136,040,203 Y142F probably benign Het
Vmn1r219 T C 13: 23,163,193 V184A possibly damaging Het
Vmn1r58 T C 7: 5,410,754 D159G probably damaging Het
Vnn3 C A 10: 23,867,248 A452D possibly damaging Het
Wscd1 T A 11: 71,788,734 Y478N probably damaging Het
Xrcc5 C T 1: 72,329,931 R315C probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121668468 missense probably benign 0.12
IGL00817:Dock9 APN 14 121698291 missense probably damaging 0.96
IGL00923:Dock9 APN 14 121607092 unclassified probably benign
IGL01385:Dock9 APN 14 121580583 missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121653084 missense probably damaging 1.00
IGL01767:Dock9 APN 14 121622870 missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121559028 missense probably damaging 1.00
IGL02512:Dock9 APN 14 121619538 splice site probably benign
IGL02525:Dock9 APN 14 121640126 missense probably damaging 1.00
IGL02550:Dock9 APN 14 121698312 start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121625147 splice site probably benign
IGL02666:Dock9 APN 14 121580699 missense probably benign 0.42
IGL02674:Dock9 APN 14 121595611 splice site probably null
IGL02795:Dock9 APN 14 121639978 missense probably benign 0.04
IGL03074:Dock9 APN 14 121607270 missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121639528 missense probably damaging 1.00
IGL03294:Dock9 APN 14 121641623 splice site probably benign
R0036:Dock9 UTSW 14 121622853 missense probably damaging 1.00
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0270:Dock9 UTSW 14 121575999 missense probably benign 0.02
R0494:Dock9 UTSW 14 121662584 missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121651768 nonsense probably null
R1029:Dock9 UTSW 14 121599684 splice site probably null
R1214:Dock9 UTSW 14 121586316 missense probably benign 0.02
R1231:Dock9 UTSW 14 121575950 missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121546064 missense probably damaging 1.00
R1629:Dock9 UTSW 14 121543574 missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121651775 missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121626880 missense probably benign 0.01
R1772:Dock9 UTSW 14 121609798 missense probably benign 0.07
R1855:Dock9 UTSW 14 121640159 missense probably damaging 1.00
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1901:Dock9 UTSW 14 121625153 splice site probably null
R1920:Dock9 UTSW 14 121583380 missense probably damaging 1.00
R1987:Dock9 UTSW 14 121591830 missense probably benign 0.00
R3035:Dock9 UTSW 14 121606837 missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121629086 splice site probably null
R4020:Dock9 UTSW 14 121606855 missense probably benign 0.00
R4021:Dock9 UTSW 14 121626912 missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121583471 missense probably damaging 1.00
R4258:Dock9 UTSW 14 121581442 missense probably benign 0.00
R4423:Dock9 UTSW 14 121562053 critical splice donor site probably null
R4561:Dock9 UTSW 14 121559007 missense probably benign 0.01
R4604:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R4646:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4647:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4776:Dock9 UTSW 14 121610097 missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121546596 missense probably benign 0.37
R4865:Dock9 UTSW 14 121543505 makesense probably null
R4951:Dock9 UTSW 14 121653135 missense probably benign 0.35
R5151:Dock9 UTSW 14 121578170 missense probably damaging 1.00
R5359:Dock9 UTSW 14 121653060 missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121578203 missense probably damaging 1.00
R5502:Dock9 UTSW 14 121610182 splice site probably null
R5579:Dock9 UTSW 14 121599695 missense probably damaging 1.00
R5753:Dock9 UTSW 14 121634625 missense probably benign 0.05
R5836:Dock9 UTSW 14 121681351 missense probably damaging 1.00
R5858:Dock9 UTSW 14 121628792 missense probably benign 0.00
R5890:Dock9 UTSW 14 121668408 critical splice donor site probably null
R6075:Dock9 UTSW 14 121545973 missense probably benign
R6298:Dock9 UTSW 14 121634594 missense probably damaging 1.00
R6306:Dock9 UTSW 14 121562080 missense probably damaging 1.00
R6321:Dock9 UTSW 14 121546021 missense probably damaging 1.00
R6330:Dock9 UTSW 14 121605243 start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121610027 missense probably damaging 1.00
R6784:Dock9 UTSW 14 121543514 missense probably damaging 1.00
R6826:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6830:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6838:Dock9 UTSW 14 121546596 missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121586264 missense probably benign 0.37
R6919:Dock9 UTSW 14 121643152 missense probably benign 0.42
R6989:Dock9 UTSW 14 121627379 missense probably damaging 1.00
R7539:Dock9 UTSW 14 121581436 missense probably damaging 1.00
R7645:Dock9 UTSW 14 121597663 missense probably benign 0.44
R7900:Dock9 UTSW 14 121546079 missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121651794 missense probably benign 0.06
R8420:Dock9 UTSW 14 121546042 missense probably damaging 1.00
R8511:Dock9 UTSW 14 121627389 missense probably benign 0.40
R8511:Dock9 UTSW 14 121681435 missense probably damaging 1.00
R8514:Dock9 UTSW 14 121658787 missense probably benign 0.25
R8691:Dock9 UTSW 14 121640105 missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121605183 missense probably damaging 0.98
R8894:Dock9 UTSW 14 121622961 missense probably benign 0.10
R8900:Dock9 UTSW 14 121580528 missense probably damaging 1.00
R9069:Dock9 UTSW 14 121628912 missense probably damaging 0.98
R9218:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R9233:Dock9 UTSW 14 121583369 missense probably benign 0.09
R9236:Dock9 UTSW 14 121639558 missense probably damaging 1.00
R9285:Dock9 UTSW 14 121595600 missense probably benign
R9451:Dock9 UTSW 14 121550189 splice site probably benign
R9461:Dock9 UTSW 14 121605189 missense probably benign 0.05
R9484:Dock9 UTSW 14 121581432 missense probably damaging 1.00
R9517:Dock9 UTSW 14 121591824 missense probably benign 0.07
R9542:Dock9 UTSW 14 121627363 missense probably damaging 1.00
R9694:Dock9 UTSW 14 121581379 missense probably damaging 1.00
R9701:Dock9 UTSW 14 121639571 missense probably benign 0.01
R9703:Dock9 UTSW 14 121544577 makesense probably null
R9726:Dock9 UTSW 14 121597737 missense possibly damaging 0.61
R9741:Dock9 UTSW 14 121640104 missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121555275 missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121651782 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTATCACATGTAAGCACCTTCTACG -3'
(R):5'- TGCAGCAGACAGGACAACTC -3'

Sequencing Primer
(F):5'- ATGTAAGCACCTTCTACGTACTTTC -3'
(R):5'- CCAGGAGGAAGGGTGTGCTC -3'
Posted On 2019-12-20