Incidental Mutation 'R7875:Aldh1a7'
ID608412
Institutional Source Beutler Lab
Gene Symbol Aldh1a7
Ensembl Gene ENSMUSG00000024747
Gene Namealdehyde dehydrogenase family 1, subfamily A7
SynonymsAldh-pb, Ahd2-like
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R7875 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location20692953-20727562 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 20715979 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 192 (V192G)
Ref Sequence ENSEMBL: ENSMUSP00000025656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025656]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025656
AA Change: V192G

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025656
Gene: ENSMUSG00000024747
AA Change: V192G

DomainStartEndE-ValueType
Pfam:Aldedh 29 492 2.5e-185 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,209,962 I1216V probably benign Het
4932415D10Rik T C 10: 82,287,622 S3185G possibly damaging Het
Acap2 A T 16: 31,139,641 F102I probably damaging Het
Acp7 A T 7: 28,614,727 Y348N probably damaging Het
Adgre4 A T 17: 55,792,016 D174V probably benign Het
Ahdc1 A G 4: 133,063,850 T801A possibly damaging Het
Anp32b T G 4: 46,451,301 D2E probably benign Het
Arhgef11 A T 3: 87,684,501 D53V probably damaging Het
Arid5b T C 10: 68,128,941 N300S probably benign Het
Ascc2 A G 11: 4,668,389 N328S probably benign Het
Aspm A T 1: 139,455,134 Q68L probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ccser1 A T 6: 61,311,948 H365L probably benign Het
Col1a2 T A 6: 4,518,500 N213K unknown Het
Col7a1 T C 9: 108,958,695 V681A unknown Het
Dock9 A T 14: 121,625,984 Y792* probably null Het
Fam241b A T 10: 62,134,492 S10R Het
Gab1 C T 8: 80,788,766 D308N probably damaging Het
Gdf11 C T 10: 128,886,341 R215H probably benign Het
Gpc1 T C 1: 92,855,248 probably null Het
Hnf4a G T 2: 163,559,060 E200* probably null Het
Ints2 T C 11: 86,213,062 T1086A probably damaging Het
Kbtbd7 A G 14: 79,427,366 T213A probably benign Het
Kcnt2 A G 1: 140,573,647 D917G probably damaging Het
Kdm5a C A 6: 120,399,018 Y578* probably null Het
Lrrtm4 A T 6: 80,022,360 T252S possibly damaging Het
Mamdc4 C T 2: 25,568,665 W305* probably null Het
Mzb1 A G 18: 35,647,860 I125T possibly damaging Het
Nfrkb A G 9: 31,410,154 T716A possibly damaging Het
Olfr1008 G A 2: 85,689,494 E22K probably benign Het
Olfr1310 A G 2: 112,008,847 V113A probably benign Het
Olfr1368 T A 13: 21,142,923 I45F probably damaging Het
Olfr582 A G 7: 103,041,853 M120V probably damaging Het
Plcxd2 G A 16: 46,009,702 A52V possibly damaging Het
Poteg C T 8: 27,449,914 P95L probably benign Het
Prdm9 A T 17: 15,553,542 Y322* probably null Het
Rab11fip2 G C 19: 59,937,223 I187M possibly damaging Het
Ranbp2 G T 10: 58,478,455 E1666* probably null Het
Rin3 T C 12: 102,369,476 S549P probably damaging Het
Scn10a C T 9: 119,635,442 probably null Het
Scn3a A G 2: 65,497,482 F888S probably damaging Het
Sik3 T A 9: 46,123,230 I96N probably damaging Het
Slc12a7 T A 13: 73,788,604 C128S possibly damaging Het
Syde2 A G 3: 146,020,265 E1304G probably damaging Het
Tagln T C 9: 45,930,382 I199V probably damaging Het
Tarsl2 T A 7: 65,678,151 V536E probably benign Het
Tas2r137 A G 6: 40,492,163 K309R probably damaging Het
Thra A T 11: 98,768,431 D462V probably damaging Het
Topaz1 A G 9: 122,749,587 T521A possibly damaging Het
Uhrf1 A G 17: 56,312,884 N265S possibly damaging Het
Upk3b A T 5: 136,040,203 Y142F probably benign Het
Vmn1r219 T C 13: 23,163,193 V184A possibly damaging Het
Vmn1r58 T C 7: 5,410,754 D159G probably damaging Het
Vnn3 C A 10: 23,867,248 A452D possibly damaging Het
Wscd1 T A 11: 71,788,734 Y478N probably damaging Het
Xrcc5 C T 1: 72,329,931 R315C probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Aldh1a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Aldh1a7 APN 19 20700046 missense probably damaging 1.00
IGL01132:Aldh1a7 APN 19 20727040 missense possibly damaging 0.76
IGL01630:Aldh1a7 APN 19 20696329 splice site probably benign
IGL01901:Aldh1a7 APN 19 20717739 missense probably damaging 0.99
IGL02324:Aldh1a7 APN 19 20727004 missense probably damaging 1.00
IGL02822:Aldh1a7 APN 19 20702266 missense possibly damaging 0.85
IGL03162:Aldh1a7 APN 19 20708281 missense probably benign 0.21
PIT4514001:Aldh1a7 UTSW 19 20702240 missense probably benign 0.07
R0125:Aldh1a7 UTSW 19 20727066 splice site probably benign
R0268:Aldh1a7 UTSW 19 20709502 critical splice acceptor site probably null
R0833:Aldh1a7 UTSW 19 20702243 missense probably damaging 1.00
R1665:Aldh1a7 UTSW 19 20727461 missense probably benign
R1709:Aldh1a7 UTSW 19 20715952 missense probably damaging 1.00
R1772:Aldh1a7 UTSW 19 20716019 missense probably damaging 1.00
R1917:Aldh1a7 UTSW 19 20727455 missense probably benign
R2570:Aldh1a7 UTSW 19 20699956 missense probably benign 0.35
R3778:Aldh1a7 UTSW 19 20719311 missense possibly damaging 0.70
R3832:Aldh1a7 UTSW 19 20708238 missense probably damaging 1.00
R3894:Aldh1a7 UTSW 19 20696398 nonsense probably null
R4601:Aldh1a7 UTSW 19 20715979 missense probably damaging 0.98
R4948:Aldh1a7 UTSW 19 20727010 missense possibly damaging 0.77
R5562:Aldh1a7 UTSW 19 20702264 nonsense probably null
R5606:Aldh1a7 UTSW 19 20722367 missense probably damaging 1.00
R5641:Aldh1a7 UTSW 19 20715929 missense probably benign 0.00
R5808:Aldh1a7 UTSW 19 20708197 missense possibly damaging 0.79
R6646:Aldh1a7 UTSW 19 20699911 missense possibly damaging 0.94
R6759:Aldh1a7 UTSW 19 20699956 missense possibly damaging 0.89
R7034:Aldh1a7 UTSW 19 20708178 missense possibly damaging 0.95
R7036:Aldh1a7 UTSW 19 20708178 missense possibly damaging 0.95
R7150:Aldh1a7 UTSW 19 20716018 missense probably damaging 1.00
R7255:Aldh1a7 UTSW 19 20714728 missense probably damaging 1.00
R7958:Aldh1a7 UTSW 19 20715979 missense possibly damaging 0.90
X0022:Aldh1a7 UTSW 19 20719315 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTGAGCAGGAGTCATGTGTG -3'
(R):5'- TCCTCCATGGATGATTTTGGGC -3'

Sequencing Primer
(F):5'- GTCATGTGTGAACAGCGAAGC -3'
(R):5'- CCATGGATGATTTTGGGCATTTTATC -3'
Posted On2019-12-20