Incidental Mutation 'R7876:Kras'
ID608435
Institutional Source Beutler Lab
Gene Symbol Kras
Ensembl Gene ENSMUSG00000030265
Gene NameKirsten rat sarcoma viral oncogene homolog
SynonymsKras-2, Ki-ras, Kras2, K-ras
MMRRC Submission
Accession Numbers

Genbank: NM_021284; MGI: 96680

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7876 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location145216699-145250239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 145225122 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 176 (K176E)
Ref Sequence ENSEMBL: ENSMUSP00000107339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032399] [ENSMUST00000111710] [ENSMUST00000156486] [ENSMUST00000203147]
Predicted Effect probably benign
Transcript: ENSMUST00000032399
SMART Domains Protein: ENSMUSP00000032399
Gene: ENSMUSG00000030265

DomainStartEndE-ValueType
RAS 1 166 1.14e-123 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111710
AA Change: K176E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107339
Gene: ENSMUSG00000030265
AA Change: K176E

DomainStartEndE-ValueType
RAS 1 166 3.7e-123 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156486
Predicted Effect probably benign
Transcript: ENSMUST00000203147
SMART Domains Protein: ENSMUSP00000145294
Gene: ENSMUSG00000030265

DomainStartEndE-ValueType
small_GTPase 1 53 3.1e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a Kirsten ras oncogene homolog from the mammalian ras gene family, encodes a protein that is a member of the small GTPase superfamily. A single amino acid substitution is responsible for an activating mutation. The transforming protein that results is implicated in various malignancies, including lung adenocarcinoma, mucinous adenoma, ductal carcinoma of the pancreas and colorectal carcinoma. Alternative splicing leads to variants encoding two isoforms that differ in the C-terminal region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality, decreased fetal growth, pericardial edema, anemia, and liver hypoplasia. Mice heterozygous for various knock-in alleles exhibit increased tumorigenesis. [provided by MGI curators]
Allele List at MGI

All alleles(26) : Targeted, knock-out(3) Targeted, other(7) Gene trapped(14) Other(2)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a A G 2: 48,870,427 K65R probably benign Het
Adprhl1 T C 8: 13,223,509 D1083G probably benign Het
Aox1 C T 1: 58,062,171 Q434* probably null Het
Atp13a5 T A 16: 29,321,748 N330I possibly damaging Het
Brd8 A G 18: 34,606,687 F678L probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C87436 T A 6: 86,446,429 probably null Het
Cacna1h A T 17: 25,375,251 I2311K probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cux1 T C 5: 136,363,307 T187A probably benign Het
Dip2b A G 15: 100,191,041 I1031V probably benign Het
Efna5 T C 17: 62,650,934 N109S possibly damaging Het
Fat2 A T 11: 55,311,220 S343T probably benign Het
Fubp1 T C 3: 152,232,291 Y654H unknown Het
Gbe1 G A 16: 70,441,171 V282I probably benign Het
Grik1 T C 16: 87,923,233 K719E Het
Grm6 A T 11: 50,859,630 Y540F probably damaging Het
Hmcn1 C T 1: 150,744,971 V1163I probably benign Het
Igkv4-53 T A 6: 69,649,003 Q60L possibly damaging Het
Igkv4-59 A T 6: 69,438,353 S73T probably damaging Het
Il1a A C 2: 129,300,842 W228G probably damaging Het
Klk13 A G 7: 43,720,979 D22G probably benign Het
Kntc1 T A 5: 123,775,787 C602S probably damaging Het
Krtap5-4 G A 7: 142,303,848 C85Y unknown Het
Map3k13 A G 16: 21,922,319 T799A probably benign Het
Mfhas1 T C 8: 35,589,543 Y391H probably damaging Het
Morf4l1 G A 9: 90,093,806 A311V possibly damaging Het
Ms4a8a T A 19: 11,079,484 Q78L probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nav3 T C 10: 109,853,498 N306S probably benign Het
Ncapd3 T C 9: 27,045,223 probably null Het
Nrg2 T A 18: 36,197,087 Y25F unknown Het
Nup153 C T 13: 46,681,608 S1407N probably benign Het
Olfr1185-ps1 A G 2: 88,499,655 Y190C probably damaging Het
Olfr1487 A G 19: 13,619,264 Y34C probably damaging Het
Olfr15 T A 16: 3,838,794 probably null Het
Pcf11 A C 7: 92,661,326 S485A probably damaging Het
Pde8a A G 7: 81,324,071 D592G probably damaging Het
Perm1 G A 4: 156,217,589 G197R probably damaging Het
Pigo A T 4: 43,020,671 M757K probably benign Het
Pls1 G A 9: 95,785,505 Q117* probably null Het
Plscr2 T C 9: 92,287,728 V77A probably benign Het
Polm T C 11: 5,831,695 E267G probably benign Het
Pomgnt1 A T 4: 116,157,909 K519M probably damaging Het
Ralyl G A 3: 14,039,790 probably null Het
Rhbdd3 C T 11: 5,105,832 T338I possibly damaging Het
Rnf31 T C 14: 55,593,077 probably null Het
Slc51a A T 16: 32,478,783 S99T probably benign Het
Sorbs1 A T 19: 40,296,588 L700H probably damaging Het
Tdrd7 G A 4: 46,025,684 V835I probably benign Het
Tmcc3 T C 10: 94,578,535 V64A probably benign Het
Tmprss5 A G 9: 49,109,091 S140G probably benign Het
Tspan11 G T 6: 127,923,666 V67F possibly damaging Het
Usp42 T C 5: 143,721,671 T252A probably damaging Het
Vmn2r97 A T 17: 18,929,064 E238V probably damaging Het
Wdpcp T A 11: 21,711,486 W253R probably benign Het
Zdhhc23 A T 16: 43,969,300 V375E probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Zmym1 A T 4: 127,047,703 M964K probably damaging Het
Other mutations in Kras
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00808:Kras APN 6 145246748 missense probably damaging 1.00
IGL02929:Kras APN 6 145232089 intron probably benign
N/A - 293:Kras UTSW 6 145232214 missense probably benign 0.01
R1463:Kras UTSW 6 145225061 intron probably benign
R1518:Kras UTSW 6 145232251 missense probably benign 0.00
R1603:Kras UTSW 6 145225145 nonsense probably null
R1885:Kras UTSW 6 145232117 missense probably damaging 1.00
R5089:Kras UTSW 6 145225143 missense probably benign 0.00
R5133:Kras UTSW 6 145232153 missense probably benign 0.00
R7710:Kras UTSW 6 145220628 missense probably benign
R8151:Kras UTSW 6 145220634 small deletion probably benign
Z1177:Kras UTSW 6 145246772 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAACCAATGACAAGGTTCTATCG -3'
(R):5'- GCTCATGTTTTAACGCTGCATC -3'

Sequencing Primer
(F):5'- GGTTCTATCGTTTAATACCTCAGAGC -3'
(R):5'- AACGCTGCATCCTCAATTTTATTC -3'
Posted On2019-12-20