Incidental Mutation 'R0147:Wdr46'
ID 60844
Institutional Source Beutler Lab
Gene Symbol Wdr46
Ensembl Gene ENSMUSG00000024312
Gene Name WD repeat domain 46
Synonyms 2310007I04Rik, Bing4
MMRRC Submission 038431-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.969) question?
Stock # R0147 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 34159634-34168671 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34159997 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 70 (F70I)
Ref Sequence ENSEMBL: ENSMUSP00000025170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025163] [ENSMUST00000025170] [ENSMUST00000047503] [ENSMUST00000173363] [ENSMUST00000174048] [ENSMUST00000179418] [ENSMUST00000174426]
AlphaFold Q9Z0H1
Predicted Effect probably benign
Transcript: ENSMUST00000025163
SMART Domains Protein: ENSMUSP00000025163
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 9.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025170
AA Change: F70I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025170
Gene: ENSMUSG00000024312
AA Change: F70I

DomainStartEndE-ValueType
coiled coil region 126 155 N/A INTRINSIC
low complexity region 204 217 N/A INTRINSIC
WD40 225 262 1.02e2 SMART
WD40 267 302 3.3e1 SMART
Blast:WD40 305 344 8e-19 BLAST
WD40 347 386 9.52e-6 SMART
Blast:WD40 392 426 3e-14 BLAST
BING4CT 439 517 8.85e-53 SMART
low complexity region 542 556 N/A INTRINSIC
low complexity region 586 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047503
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172546
Predicted Effect probably benign
Transcript: ENSMUST00000173284
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173363
SMART Domains Protein: ENSMUSP00000138662
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173857
Predicted Effect probably benign
Transcript: ENSMUST00000174048
SMART Domains Protein: ENSMUSP00000133656
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174442
Predicted Effect probably benign
Transcript: ENSMUST00000179418
SMART Domains Protein: ENSMUSP00000137072
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174426
SMART Domains Protein: ENSMUSP00000134069
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 94.5%
  • 20x: 86.1%
Validation Efficiency 67% (88/131)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,639,405 (GRCm39) probably null Het
Abtb2 A G 2: 103,397,480 (GRCm39) I137V probably benign Het
Ank1 T A 8: 23,613,993 (GRCm39) N1545K probably damaging Het
Arl6 T C 16: 59,439,153 (GRCm39) probably benign Het
Avl9 T A 6: 56,713,487 (GRCm39) D248E probably benign Het
Becn1 T C 11: 101,192,562 (GRCm39) E40G probably damaging Het
Bod1l G T 5: 41,976,040 (GRCm39) A1758E possibly damaging Het
Btbd16 C T 7: 130,381,324 (GRCm39) T19I probably damaging Het
Casc3 T A 11: 98,713,325 (GRCm39) N246K possibly damaging Het
Celf1 G T 2: 90,835,035 (GRCm39) probably benign Het
Chrm3 G T 13: 9,928,780 (GRCm39) N85K probably damaging Het
Cluh T A 11: 74,556,764 (GRCm39) Y935N probably damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Col6a5 T C 9: 105,802,993 (GRCm39) D1324G unknown Het
Ctcfl T C 2: 172,960,340 (GRCm39) D81G possibly damaging Het
D630003M21Rik C T 2: 158,044,987 (GRCm39) probably benign Het
Ddx39a C T 8: 84,449,105 (GRCm39) R298C possibly damaging Het
Dnmt3b T G 2: 153,503,377 (GRCm39) N9K possibly damaging Het
Dock8 T C 19: 25,096,823 (GRCm39) L577P probably benign Het
Drc1 A T 5: 30,486,487 (GRCm39) N13I possibly damaging Het
Eml4 T A 17: 83,729,081 (GRCm39) N85K probably damaging Het
Epb41l4a T C 18: 33,931,853 (GRCm39) T581A probably damaging Het
Epha3 T C 16: 63,433,307 (GRCm39) D446G possibly damaging Het
Fam209 G T 2: 172,315,900 (GRCm39) G92C probably damaging Het
Fam98c T A 7: 28,852,146 (GRCm39) R340* probably null Het
Fbxw10 T G 11: 62,738,307 (GRCm39) probably null Het
Galr1 A G 18: 82,423,695 (GRCm39) L194P probably benign Het
Gar1 T C 3: 129,623,122 (GRCm39) H89R probably damaging Het
Gbp4 T A 5: 105,267,362 (GRCm39) Y519F probably benign Het
Gm28042 T A 2: 119,866,944 (GRCm39) S196T probably benign Het
Grid2 T C 6: 64,510,571 (GRCm39) Y734H probably benign Het
Grm6 T A 11: 50,750,144 (GRCm39) I466N possibly damaging Het
Hectd3 T C 4: 116,854,237 (GRCm39) probably benign Het
Hpse2 A C 19: 42,920,099 (GRCm39) probably null Het
Hspb7 T C 4: 141,151,302 (GRCm39) I148T probably damaging Het
Htr1d C A 4: 136,170,788 (GRCm39) T339K probably damaging Het
Ip6k1 T A 9: 107,923,093 (GRCm39) D408E probably damaging Het
Irs2 A T 8: 11,057,568 (GRCm39) M288K probably damaging Het
Kansl3 A T 1: 36,392,897 (GRCm39) C225S probably damaging Het
Knop1 C A 7: 118,445,061 (GRCm39) R301L probably benign Het
Lama5 T C 2: 179,832,199 (GRCm39) H1714R probably benign Het
Mettl14 G A 3: 123,165,043 (GRCm39) T316I probably damaging Het
Mmp15 A T 8: 96,098,945 (GRCm39) N591Y probably benign Het
Mprip T A 11: 59,627,899 (GRCm39) D93E possibly damaging Het
Mtmr14 T A 6: 113,237,627 (GRCm39) probably benign Het
Muc5ac T C 7: 141,364,776 (GRCm39) S1917P probably benign Het
Muc6 C T 7: 141,238,255 (GRCm39) C75Y probably damaging Het
Naip1 A T 13: 100,563,418 (GRCm39) H582Q possibly damaging Het
Nbeal2 G A 9: 110,471,211 (GRCm39) R264* probably null Het
Neb T C 2: 52,139,388 (GRCm39) K140E probably damaging Het
Nfya A G 17: 48,706,026 (GRCm39) V48A possibly damaging Het
Ngf G T 3: 102,417,119 (GRCm39) probably benign Het
Nsmce2 T G 15: 59,250,806 (GRCm39) S26A probably damaging Het
Or52s19 T C 7: 103,007,613 (GRCm39) T263A possibly damaging Het
Or5m13b T A 2: 85,754,362 (GRCm39) I250N possibly damaging Het
Or7e177 T G 9: 20,212,387 (GRCm39) M297R probably damaging Het
Pax1 A G 2: 147,215,654 (GRCm39) S424G probably benign Het
Pcdhb19 A T 18: 37,630,235 (GRCm39) Q10L probably benign Het
Pdcl T C 2: 37,242,142 (GRCm39) I203V probably benign Het
Pknox1 T A 17: 31,823,764 (GRCm39) N379K probably benign Het
Plxna1 C T 6: 89,297,692 (GRCm39) A1831T possibly damaging Het
Prodh T G 16: 17,895,677 (GRCm39) Q360P probably damaging Het
Pygo2 T C 3: 89,340,610 (GRCm39) V299A probably damaging Het
Raf1 C T 6: 115,609,934 (GRCm39) G202S probably benign Het
Rgs11 T A 17: 26,426,433 (GRCm39) probably null Het
Rmc1 C T 18: 12,322,328 (GRCm39) R594C probably damaging Het
Rnf13 A G 3: 57,709,889 (GRCm39) D144G probably damaging Het
Rtel1 T C 2: 180,962,839 (GRCm39) C31R probably damaging Het
Rubcnl T A 14: 75,279,898 (GRCm39) I427K probably damaging Het
Sec23ip C T 7: 128,380,775 (GRCm39) probably benign Het
Slc25a26 T A 6: 94,569,507 (GRCm39) probably null Het
Slc6a7 A G 18: 61,135,183 (GRCm39) probably benign Het
Slco6b1 A T 1: 96,915,562 (GRCm39) noncoding transcript Het
Spata17 A G 1: 186,844,798 (GRCm39) V111A probably damaging Het
Spata22 T A 11: 73,221,979 (GRCm39) M1K probably null Het
Svep1 C T 4: 58,116,608 (GRCm39) D881N possibly damaging Het
Sypl2 T A 3: 108,126,411 (GRCm39) N67I possibly damaging Het
Tasor A G 14: 27,193,725 (GRCm39) D975G probably benign Het
Tenm3 T C 8: 48,689,755 (GRCm39) Y1944C probably damaging Het
Tm9sf4 G T 2: 153,037,233 (GRCm39) V365L probably benign Het
Tmc3 T C 7: 83,256,950 (GRCm39) V401A probably damaging Het
Trpm2 C T 10: 77,761,659 (GRCm39) G997D probably damaging Het
Unc5b A T 10: 60,608,076 (GRCm39) S675T probably damaging Het
Vmn1r217 A G 13: 23,298,107 (GRCm39) M265T probably benign Het
Vps54 T A 11: 21,250,259 (GRCm39) D548E probably benign Het
Wdfy3 A G 5: 102,065,277 (GRCm39) V1297A probably benign Het
Zdbf2 C T 1: 63,343,165 (GRCm39) Q515* probably null Het
Zfp710 T A 7: 79,731,721 (GRCm39) C299* probably null Het
Other mutations in Wdr46
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0148:Wdr46 UTSW 17 34,159,997 (GRCm39) missense probably benign
R1405:Wdr46 UTSW 17 34,168,057 (GRCm39) missense probably damaging 1.00
R1405:Wdr46 UTSW 17 34,168,057 (GRCm39) missense probably damaging 1.00
R2085:Wdr46 UTSW 17 34,160,425 (GRCm39) nonsense probably null
R4319:Wdr46 UTSW 17 34,159,718 (GRCm39) missense probably benign 0.04
R4368:Wdr46 UTSW 17 34,160,120 (GRCm39) unclassified probably benign
R4831:Wdr46 UTSW 17 34,168,373 (GRCm39) unclassified probably benign
R4831:Wdr46 UTSW 17 34,160,810 (GRCm39) missense probably benign 0.17
R5118:Wdr46 UTSW 17 34,167,811 (GRCm39) missense possibly damaging 0.65
R6211:Wdr46 UTSW 17 34,163,459 (GRCm39) missense probably damaging 1.00
R6347:Wdr46 UTSW 17 34,160,826 (GRCm39) missense probably damaging 1.00
R6529:Wdr46 UTSW 17 34,168,120 (GRCm39) missense possibly damaging 0.78
R7318:Wdr46 UTSW 17 34,160,859 (GRCm39) critical splice donor site probably null
R8699:Wdr46 UTSW 17 34,167,826 (GRCm39) missense probably damaging 1.00
R8993:Wdr46 UTSW 17 34,168,156 (GRCm39) missense probably benign 0.00
R9072:Wdr46 UTSW 17 34,163,555 (GRCm39) missense probably benign 0.03
R9174:Wdr46 UTSW 17 34,167,668 (GRCm39) missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TTTCCTAGACCGCCGAGCTACTAC -3'
(R):5'- ATTCGACAAAACTTCCGGGCCTCC -3'

Sequencing Primer
(F):5'- TACTCAAGGGAGTTTCGCAC -3'
(R):5'- TGGGAACGGGTCCTGAG -3'
Posted On 2013-07-24