Incidental Mutation 'R7876:Adprhl1'
ID608441
Institutional Source Beutler Lab
Gene Symbol Adprhl1
Ensembl Gene ENSMUSG00000031448
Gene NameADP-ribosylhydrolase like 1
SynonymsArh2, D330008N11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7876 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location13221663-13254162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13223509 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1083 (D1083G)
Ref Sequence ENSEMBL: ENSMUSP00000145145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000204916]
Predicted Effect probably benign
Transcript: ENSMUST00000204916
AA Change: D1083G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000145145
Gene: ENSMUSG00000031448
AA Change: D1083G

DomainStartEndE-ValueType
Pfam:ADP_ribosyl_GH 6 327 4.2e-49 PFAM
low complexity region 509 527 N/A INTRINSIC
low complexity region 955 969 N/A INTRINSIC
internal_repeat_1 1047 1150 1.82e-5 PROSPERO
internal_repeat_1 1157 1274 1.82e-5 PROSPERO
low complexity region 1275 1290 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation is a reversible posttranslational modification used to regulate protein function. ADP-ribosyltransferases (see ART1; MIM 601625) transfer ADP-ribose from NAD+ to the target protein, and ADP-ribosylhydrolases, such as ADPRHL1, reverse the reaction (Glowacki et al., 2002 [PubMed 12070318]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a A G 2: 48,870,427 K65R probably benign Het
Aox1 C T 1: 58,062,171 Q434* probably null Het
Atp13a5 T A 16: 29,321,748 N330I possibly damaging Het
Brd8 A G 18: 34,606,687 F678L probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C87436 T A 6: 86,446,429 probably null Het
Cacna1h A T 17: 25,375,251 I2311K probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cux1 T C 5: 136,363,307 T187A probably benign Het
Dip2b A G 15: 100,191,041 I1031V probably benign Het
Efna5 T C 17: 62,650,934 N109S possibly damaging Het
Fat2 A T 11: 55,311,220 S343T probably benign Het
Fubp1 T C 3: 152,232,291 Y654H unknown Het
Gbe1 G A 16: 70,441,171 V282I probably benign Het
Grik1 T C 16: 87,923,233 K719E Het
Grm6 A T 11: 50,859,630 Y540F probably damaging Het
Hmcn1 C T 1: 150,744,971 V1163I probably benign Het
Igkv4-53 T A 6: 69,649,003 Q60L possibly damaging Het
Igkv4-59 A T 6: 69,438,353 S73T probably damaging Het
Il1a A C 2: 129,300,842 W228G probably damaging Het
Klk13 A G 7: 43,720,979 D22G probably benign Het
Kntc1 T A 5: 123,775,787 C602S probably damaging Het
Kras T C 6: 145,225,122 K176E probably benign Het
Krtap5-4 G A 7: 142,303,848 C85Y unknown Het
Map3k13 A G 16: 21,922,319 T799A probably benign Het
Mfhas1 T C 8: 35,589,543 Y391H probably damaging Het
Morf4l1 G A 9: 90,093,806 A311V possibly damaging Het
Ms4a8a T A 19: 11,079,484 Q78L probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nav3 T C 10: 109,853,498 N306S probably benign Het
Ncapd3 T C 9: 27,045,223 probably null Het
Nrg2 T A 18: 36,197,087 Y25F unknown Het
Nup153 C T 13: 46,681,608 S1407N probably benign Het
Olfr1185-ps1 A G 2: 88,499,655 Y190C probably damaging Het
Olfr1487 A G 19: 13,619,264 Y34C probably damaging Het
Olfr15 T A 16: 3,838,794 probably null Het
Pcf11 A C 7: 92,661,326 S485A probably damaging Het
Pde8a A G 7: 81,324,071 D592G probably damaging Het
Perm1 G A 4: 156,217,589 G197R probably damaging Het
Pigo A T 4: 43,020,671 M757K probably benign Het
Pls1 G A 9: 95,785,505 Q117* probably null Het
Plscr2 T C 9: 92,287,728 V77A probably benign Het
Polm T C 11: 5,831,695 E267G probably benign Het
Pomgnt1 A T 4: 116,157,909 K519M probably damaging Het
Ralyl G A 3: 14,039,790 probably null Het
Rhbdd3 C T 11: 5,105,832 T338I possibly damaging Het
Rnf31 T C 14: 55,593,077 probably null Het
Slc51a A T 16: 32,478,783 S99T probably benign Het
Sorbs1 A T 19: 40,296,588 L700H probably damaging Het
Tdrd7 G A 4: 46,025,684 V835I probably benign Het
Tmcc3 T C 10: 94,578,535 V64A probably benign Het
Tmprss5 A G 9: 49,109,091 S140G probably benign Het
Tspan11 G T 6: 127,923,666 V67F possibly damaging Het
Usp42 T C 5: 143,721,671 T252A probably damaging Het
Vmn2r97 A T 17: 18,929,064 E238V probably damaging Het
Wdpcp T A 11: 21,711,486 W253R probably benign Het
Zdhhc23 A T 16: 43,969,300 V375E probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Zmym1 A T 4: 127,047,703 M964K probably damaging Het
Other mutations in Adprhl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03268:Adprhl1 APN 8 13246170 splice site probably benign
BB003:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
BB004:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
BB005:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
BB006:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
BB013:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
BB014:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
BB015:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
BB016:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R0244:Adprhl1 UTSW 8 13242391 splice site probably benign
R0636:Adprhl1 UTSW 8 13248702 missense probably damaging 1.00
R1295:Adprhl1 UTSW 8 13248624 missense probably damaging 1.00
R2111:Adprhl1 UTSW 8 13248694 missense probably damaging 1.00
R2112:Adprhl1 UTSW 8 13248694 missense probably damaging 1.00
R2184:Adprhl1 UTSW 8 13242559 missense probably benign 0.00
R4411:Adprhl1 UTSW 8 13246114 missense probably benign 0.16
R4412:Adprhl1 UTSW 8 13246114 missense probably benign 0.16
R4413:Adprhl1 UTSW 8 13246114 missense probably benign 0.16
R4615:Adprhl1 UTSW 8 13242250 critical splice donor site probably null
R4618:Adprhl1 UTSW 8 13242250 critical splice donor site probably null
R5016:Adprhl1 UTSW 8 13224889 missense possibly damaging 0.88
R5058:Adprhl1 UTSW 8 13242625 missense probably damaging 1.00
R5060:Adprhl1 UTSW 8 13248621 missense possibly damaging 0.63
R5209:Adprhl1 UTSW 8 13242563 nonsense probably null
R6103:Adprhl1 UTSW 8 13222055 missense possibly damaging 0.91
R6158:Adprhl1 UTSW 8 13224977 missense possibly damaging 0.93
R6221:Adprhl1 UTSW 8 13225634 missense probably benign 0.01
R6971:Adprhl1 UTSW 8 13223476 missense probably benign
R7087:Adprhl1 UTSW 8 13221856 missense probably damaging 0.99
R7362:Adprhl1 UTSW 8 13245534 missense probably damaging 1.00
R7404:Adprhl1 UTSW 8 13225118 missense probably damaging 0.99
R7422:Adprhl1 UTSW 8 13222873 missense probably benign 0.28
R7439:Adprhl1 UTSW 8 13223069 missense probably benign 0.01
R7441:Adprhl1 UTSW 8 13223069 missense probably benign 0.01
R7772:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7773:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7774:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7776:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7877:Adprhl1 UTSW 8 13225316 nonsense probably null
R7926:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7927:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7928:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7929:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7944:Adprhl1 UTSW 8 13221929 missense probably damaging 0.99
R7945:Adprhl1 UTSW 8 13221929 missense probably damaging 0.99
R7946:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7947:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7949:Adprhl1 UTSW 8 13224225 missense possibly damaging 0.93
R8155:Adprhl1 UTSW 8 13221764 missense probably damaging 0.99
R8182:Adprhl1 UTSW 8 13222774 missense probably benign 0.07
Z1176:Adprhl1 UTSW 8 13225613 missense probably benign 0.01
Z1177:Adprhl1 UTSW 8 13245476 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- ACCTCGTGTTTAGGCTCCTG -3'
(R):5'- TCAGGAAAACAGCAGCCATG -3'

Sequencing Primer
(F):5'- CGTGTTTAGGCTCCTGGGAAC -3'
(R):5'- CCATGATTTGGGTAGCAACAGCC -3'
Posted On2019-12-20