Incidental Mutation 'R7876:Map3k13'
ID 608458
Institutional Source Beutler Lab
Gene Symbol Map3k13
Ensembl Gene ENSMUSG00000033618
Gene Name mitogen-activated protein kinase kinase kinase 13
Synonyms C130026N12Rik
MMRRC Submission 045928-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7876 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 21643923-21752189 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 21741069 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 799 (T799A)
Ref Sequence ENSEMBL: ENSMUSP00000047388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042065] [ENSMUST00000231988] [ENSMUST00000232240]
AlphaFold Q1HKZ5
Predicted Effect probably benign
Transcript: ENSMUST00000042065
AA Change: T799A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047388
Gene: ENSMUSG00000033618
AA Change: T799A

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
Pfam:Pkinase 167 406 3.1e-60 PFAM
Pfam:Pkinase_Tyr 167 406 2.4e-65 PFAM
coiled coil region 456 502 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
low complexity region 805 821 N/A INTRINSIC
low complexity region 833 843 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231988
AA Change: T799A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000232240
AA Change: T799A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of serine/threonine protein kinase family. This kinase contains a dual leucine-zipper motif, and has been shown to form dimers/oligomers through its leucine-zipper motif. This kinase can phosphorylate and activate MAPK8/JNK, MAP2K7/MKK7, which suggests a role in the JNK signaling pathway. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a A G 2: 48,760,439 (GRCm39) K65R probably benign Het
Adprhl1 T C 8: 13,273,509 (GRCm39) D1083G probably benign Het
Aox1 C T 1: 58,101,330 (GRCm39) Q434* probably null Het
Atp13a5 T A 16: 29,140,566 (GRCm39) N330I possibly damaging Het
Brd8 A G 18: 34,739,740 (GRCm39) F678L probably benign Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
C87436 T A 6: 86,423,411 (GRCm39) probably null Het
Cacna1h A T 17: 25,594,225 (GRCm39) I2311K probably benign Het
Ccng2 C G 5: 93,421,202 (GRCm39) S237R probably benign Het
Cux1 T C 5: 136,392,161 (GRCm39) T187A probably benign Het
Dip2b A G 15: 100,088,922 (GRCm39) I1031V probably benign Het
Efna5 T C 17: 62,957,929 (GRCm39) N109S possibly damaging Het
Fat2 A T 11: 55,202,046 (GRCm39) S343T probably benign Het
Fubp1 T C 3: 151,937,928 (GRCm39) Y654H unknown Het
Gbe1 G A 16: 70,238,059 (GRCm39) V282I probably benign Het
Grik1 T C 16: 87,720,121 (GRCm39) K719E Het
Grm6 A T 11: 50,750,457 (GRCm39) Y540F probably damaging Het
Hmcn1 C T 1: 150,620,722 (GRCm39) V1163I probably benign Het
Igkv4-53 T A 6: 69,625,987 (GRCm39) Q60L possibly damaging Het
Igkv4-59 A T 6: 69,415,337 (GRCm39) S73T probably damaging Het
Il1a A C 2: 129,142,762 (GRCm39) W228G probably damaging Het
Klk13 A G 7: 43,370,403 (GRCm39) D22G probably benign Het
Kntc1 T A 5: 123,913,850 (GRCm39) C602S probably damaging Het
Kras T C 6: 145,170,848 (GRCm39) K176E probably benign Het
Krtap5-4 G A 7: 141,857,585 (GRCm39) C85Y unknown Het
Mfhas1 T C 8: 36,056,697 (GRCm39) Y391H probably damaging Het
Morf4l1 G A 9: 89,975,859 (GRCm39) A311V possibly damaging Het
Ms4a8a T A 19: 11,056,848 (GRCm39) Q78L probably damaging Het
Muc5ac G C 7: 141,363,040 (GRCm39) G2117A unknown Het
Nav3 T C 10: 109,689,359 (GRCm39) N306S probably benign Het
Ncapd3 T C 9: 26,956,519 (GRCm39) probably null Het
Nrg2 T A 18: 36,330,140 (GRCm39) Y25F unknown Het
Nup153 C T 13: 46,835,084 (GRCm39) S1407N probably benign Het
Or2c1 T A 16: 3,656,658 (GRCm39) probably null Het
Or4c99 A G 2: 88,329,999 (GRCm39) Y190C probably damaging Het
Or5b123 A G 19: 13,596,628 (GRCm39) Y34C probably damaging Het
Pcf11 A C 7: 92,310,534 (GRCm39) S485A probably damaging Het
Pde8a A G 7: 80,973,819 (GRCm39) D592G probably damaging Het
Perm1 G A 4: 156,302,046 (GRCm39) G197R probably damaging Het
Pigo A T 4: 43,020,671 (GRCm39) M757K probably benign Het
Pls1 G A 9: 95,667,558 (GRCm39) Q117* probably null Het
Plscr2 T C 9: 92,169,781 (GRCm39) V77A probably benign Het
Polm T C 11: 5,781,695 (GRCm39) E267G probably benign Het
Pomgnt1 A T 4: 116,015,106 (GRCm39) K519M probably damaging Het
Ralyl G A 3: 14,104,850 (GRCm39) probably null Het
Rhbdd3 C T 11: 5,055,832 (GRCm39) T338I possibly damaging Het
Rnf31 T C 14: 55,830,534 (GRCm39) probably null Het
Slc51a A T 16: 32,297,601 (GRCm39) S99T probably benign Het
Sorbs1 A T 19: 40,285,032 (GRCm39) L700H probably damaging Het
Tdrd7 G A 4: 46,025,684 (GRCm39) V835I probably benign Het
Tmcc3 T C 10: 94,414,397 (GRCm39) V64A probably benign Het
Tmprss5 A G 9: 49,020,391 (GRCm39) S140G probably benign Het
Tspan11 G T 6: 127,900,629 (GRCm39) V67F possibly damaging Het
Usp42 T C 5: 143,707,426 (GRCm39) T252A probably damaging Het
Vmn2r97 A T 17: 19,149,326 (GRCm39) E238V probably damaging Het
Wdpcp T A 11: 21,661,486 (GRCm39) W253R probably benign Het
Zdhhc23 A T 16: 43,789,663 (GRCm39) V375E probably damaging Het
Zkscan5 A C 5: 145,157,676 (GRCm39) H726P probably damaging Het
Zmym1 A T 4: 126,941,496 (GRCm39) M964K probably damaging Het
Other mutations in Map3k13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Map3k13 APN 16 21,740,514 (GRCm39) missense probably benign 0.00
IGL01092:Map3k13 APN 16 21,746,766 (GRCm39) missense probably damaging 0.97
IGL01958:Map3k13 APN 16 21,710,873 (GRCm39) missense probably benign
IGL02444:Map3k13 APN 16 21,732,982 (GRCm39) missense probably benign 0.19
IGL02503:Map3k13 APN 16 21,727,454 (GRCm39) missense possibly damaging 0.50
IGL02712:Map3k13 APN 16 21,724,005 (GRCm39) missense probably damaging 0.99
IGL03342:Map3k13 APN 16 21,710,981 (GRCm39) missense possibly damaging 0.94
R0086:Map3k13 UTSW 16 21,732,975 (GRCm39) missense probably damaging 0.98
R0124:Map3k13 UTSW 16 21,722,506 (GRCm39) missense possibly damaging 0.95
R0281:Map3k13 UTSW 16 21,732,907 (GRCm39) missense probably damaging 1.00
R0308:Map3k13 UTSW 16 21,710,738 (GRCm39) missense probably benign
R0601:Map3k13 UTSW 16 21,723,999 (GRCm39) missense possibly damaging 0.95
R0669:Map3k13 UTSW 16 21,725,274 (GRCm39) missense probably benign 0.03
R0918:Map3k13 UTSW 16 21,744,990 (GRCm39) missense probably damaging 1.00
R1641:Map3k13 UTSW 16 21,722,542 (GRCm39) missense probably damaging 1.00
R1838:Map3k13 UTSW 16 21,732,939 (GRCm39) missense possibly damaging 0.92
R1891:Map3k13 UTSW 16 21,729,836 (GRCm39) missense probably damaging 1.00
R2125:Map3k13 UTSW 16 21,710,894 (GRCm39) missense probably benign 0.01
R2332:Map3k13 UTSW 16 21,717,427 (GRCm39) splice site probably null
R2361:Map3k13 UTSW 16 21,725,286 (GRCm39) missense probably benign 0.05
R4395:Map3k13 UTSW 16 21,717,321 (GRCm39) missense possibly damaging 0.49
R4505:Map3k13 UTSW 16 21,740,928 (GRCm39) missense probably benign 0.00
R4506:Map3k13 UTSW 16 21,740,928 (GRCm39) missense probably benign 0.00
R4521:Map3k13 UTSW 16 21,724,525 (GRCm39) missense possibly damaging 0.94
R4753:Map3k13 UTSW 16 21,710,752 (GRCm39) missense probably benign
R4952:Map3k13 UTSW 16 21,729,769 (GRCm39) missense probably benign 0.15
R5035:Map3k13 UTSW 16 21,740,421 (GRCm39) missense probably benign 0.03
R5327:Map3k13 UTSW 16 21,740,397 (GRCm39) missense possibly damaging 0.89
R5784:Map3k13 UTSW 16 21,717,391 (GRCm39) missense possibly damaging 0.68
R5831:Map3k13 UTSW 16 21,746,798 (GRCm39) makesense probably null
R5996:Map3k13 UTSW 16 21,723,995 (GRCm39) missense possibly damaging 0.95
R6007:Map3k13 UTSW 16 21,723,933 (GRCm39) missense possibly damaging 0.95
R6546:Map3k13 UTSW 16 21,740,527 (GRCm39) missense probably benign 0.15
R6620:Map3k13 UTSW 16 21,711,061 (GRCm39) missense possibly damaging 0.62
R6683:Map3k13 UTSW 16 21,711,062 (GRCm39) missense probably benign 0.32
R6692:Map3k13 UTSW 16 21,723,987 (GRCm39) missense possibly damaging 0.66
R6695:Map3k13 UTSW 16 21,741,028 (GRCm39) missense probably benign 0.10
R6743:Map3k13 UTSW 16 21,711,173 (GRCm39) missense probably damaging 0.98
R6822:Map3k13 UTSW 16 21,741,013 (GRCm39) missense probably benign 0.00
R6965:Map3k13 UTSW 16 21,740,900 (GRCm39) missense probably benign
R7149:Map3k13 UTSW 16 21,744,187 (GRCm39) missense probably benign 0.04
R7174:Map3k13 UTSW 16 21,745,006 (GRCm39) missense probably damaging 1.00
R7256:Map3k13 UTSW 16 21,710,988 (GRCm39) missense probably benign 0.03
R7400:Map3k13 UTSW 16 21,741,072 (GRCm39) missense probably damaging 1.00
R7733:Map3k13 UTSW 16 21,740,436 (GRCm39) missense probably damaging 1.00
R7848:Map3k13 UTSW 16 21,724,621 (GRCm39) missense probably damaging 0.98
R7871:Map3k13 UTSW 16 21,740,346 (GRCm39) missense probably benign 0.09
R8002:Map3k13 UTSW 16 21,723,878 (GRCm39) missense probably benign 0.05
R8089:Map3k13 UTSW 16 21,722,567 (GRCm39) missense possibly damaging 0.48
R8341:Map3k13 UTSW 16 21,740,334 (GRCm39) nonsense probably null
R8738:Map3k13 UTSW 16 21,745,008 (GRCm39) missense probably damaging 1.00
R8940:Map3k13 UTSW 16 21,727,454 (GRCm39) missense possibly damaging 0.50
R8949:Map3k13 UTSW 16 21,723,882 (GRCm39) missense probably benign 0.05
R9391:Map3k13 UTSW 16 21,740,665 (GRCm39) missense probably benign 0.00
R9749:Map3k13 UTSW 16 21,740,581 (GRCm39) missense probably benign 0.00
R9802:Map3k13 UTSW 16 21,740,518 (GRCm39) missense possibly damaging 0.85
Z1176:Map3k13 UTSW 16 21,723,912 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGTCTTTAGATGTTCCCAC -3'
(R):5'- TGTCTCCCAGGCCAGTAATC -3'

Sequencing Primer
(F):5'- TAGATGTTCCCACTACTGAGCCAG -3'
(R):5'- CCACCACTGAAGTGCTGTG -3'
Posted On 2019-12-20