Incidental Mutation 'R7876:Efna5'
ID608466
Institutional Source Beutler Lab
Gene Symbol Efna5
Ensembl Gene ENSMUSG00000048915
Gene Nameephrin A5
SynonymsEFL-5, Epl7, RAGS, AL-1, LERK-7, Ephrin-A5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7876 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location62604184-62881317 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62650934 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 109 (N109S)
Ref Sequence ENSEMBL: ENSMUSP00000076115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076840] [ENSMUST00000078839]
PDB Structure
EphB2 / EphrinA5 Complex Structure [X-RAY DIFFRACTION]
Ephrin A5 ligand structure [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076840
AA Change: N109S

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000076115
Gene: ENSMUSG00000048915
AA Change: N109S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Ephrin 29 158 4.5e-42 PFAM
low complexity region 214 228 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000078839
AA Change: N109S

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000077883
Gene: ENSMUSG00000048915
AA Change: N109S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Ephrin 26 164 2.4e-58 PFAM
low complexity region 187 201 N/A INTRINSIC
Meta Mutation Damage Score 0.0715 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin-A5, a member of the ephrin gene family, prevents axon bundling in cocultures of cortical neurons with astrocytes, a model of late stage nervous system development and differentiation. The EPH and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, particularly in the nervous system. EPH receptors typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin ligands and receptors have been named by the Eph Nomenclature Committee (1997). Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are similarly divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit abnormalities in establishing correct axonal connections involving the retinal, motor, vomeronasal, and tactile axons to their respective targets. Some mutants develop neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a A G 2: 48,870,427 K65R probably benign Het
Adprhl1 T C 8: 13,223,509 D1083G probably benign Het
Aox1 C T 1: 58,062,171 Q434* probably null Het
Atp13a5 T A 16: 29,321,748 N330I possibly damaging Het
Brd8 A G 18: 34,606,687 F678L probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C87436 T A 6: 86,446,429 probably null Het
Cacna1h A T 17: 25,375,251 I2311K probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cux1 T C 5: 136,363,307 T187A probably benign Het
Dip2b A G 15: 100,191,041 I1031V probably benign Het
Fat2 A T 11: 55,311,220 S343T probably benign Het
Fubp1 T C 3: 152,232,291 Y654H unknown Het
Gbe1 G A 16: 70,441,171 V282I probably benign Het
Grik1 T C 16: 87,923,233 K719E Het
Grm6 A T 11: 50,859,630 Y540F probably damaging Het
Hmcn1 C T 1: 150,744,971 V1163I probably benign Het
Igkv4-53 T A 6: 69,649,003 Q60L possibly damaging Het
Igkv4-59 A T 6: 69,438,353 S73T probably damaging Het
Il1a A C 2: 129,300,842 W228G probably damaging Het
Klk13 A G 7: 43,720,979 D22G probably benign Het
Kntc1 T A 5: 123,775,787 C602S probably damaging Het
Kras T C 6: 145,225,122 K176E probably benign Het
Krtap5-4 G A 7: 142,303,848 C85Y unknown Het
Map3k13 A G 16: 21,922,319 T799A probably benign Het
Mfhas1 T C 8: 35,589,543 Y391H probably damaging Het
Morf4l1 G A 9: 90,093,806 A311V possibly damaging Het
Ms4a8a T A 19: 11,079,484 Q78L probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Nav3 T C 10: 109,853,498 N306S probably benign Het
Ncapd3 T C 9: 27,045,223 probably null Het
Nrg2 T A 18: 36,197,087 Y25F unknown Het
Nup153 C T 13: 46,681,608 S1407N probably benign Het
Olfr1185-ps1 A G 2: 88,499,655 Y190C probably damaging Het
Olfr1487 A G 19: 13,619,264 Y34C probably damaging Het
Olfr15 T A 16: 3,838,794 probably null Het
Pcf11 A C 7: 92,661,326 S485A probably damaging Het
Pde8a A G 7: 81,324,071 D592G probably damaging Het
Perm1 G A 4: 156,217,589 G197R probably damaging Het
Pigo A T 4: 43,020,671 M757K probably benign Het
Pls1 G A 9: 95,785,505 Q117* probably null Het
Plscr2 T C 9: 92,287,728 V77A probably benign Het
Polm T C 11: 5,831,695 E267G probably benign Het
Pomgnt1 A T 4: 116,157,909 K519M probably damaging Het
Ralyl G A 3: 14,039,790 probably null Het
Rhbdd3 C T 11: 5,105,832 T338I possibly damaging Het
Rnf31 T C 14: 55,593,077 probably null Het
Slc51a A T 16: 32,478,783 S99T probably benign Het
Sorbs1 A T 19: 40,296,588 L700H probably damaging Het
Tdrd7 G A 4: 46,025,684 V835I probably benign Het
Tmcc3 T C 10: 94,578,535 V64A probably benign Het
Tmprss5 A G 9: 49,109,091 S140G probably benign Het
Tspan11 G T 6: 127,923,666 V67F possibly damaging Het
Usp42 T C 5: 143,721,671 T252A probably damaging Het
Vmn2r97 A T 17: 18,929,064 E238V probably damaging Het
Wdpcp T A 11: 21,711,486 W253R probably benign Het
Zdhhc23 A T 16: 43,969,300 V375E probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Zmym1 A T 4: 127,047,703 M964K probably damaging Het
Other mutations in Efna5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Efna5 APN 17 62613379 missense possibly damaging 0.73
IGL02142:Efna5 APN 17 62607345 missense unknown
IGL02152:Efna5 APN 17 62651060 missense probably benign
IGL02534:Efna5 APN 17 62613389 nonsense probably null
IGL02556:Efna5 APN 17 62651028 missense probably damaging 0.99
R0041:Efna5 UTSW 17 62607472 splice site probably benign
R0265:Efna5 UTSW 17 62651073 missense probably damaging 1.00
R0422:Efna5 UTSW 17 62607419 missense probably benign 0.05
R0565:Efna5 UTSW 17 62881036 missense probably damaging 1.00
R2039:Efna5 UTSW 17 62881066 missense probably benign 0.00
R2570:Efna5 UTSW 17 62881028 missense probably benign 0.04
R4621:Efna5 UTSW 17 62651045 missense probably benign 0.00
R4622:Efna5 UTSW 17 62651045 missense probably benign 0.00
R5672:Efna5 UTSW 17 62881030 missense probably damaging 1.00
R5723:Efna5 UTSW 17 62607463 missense probably damaging 1.00
R8049:Efna5 UTSW 17 62650982 missense probably benign 0.39
R8432:Efna5 UTSW 17 62651022 missense probably damaging 1.00
RF007:Efna5 UTSW 17 62613394 missense probably benign 0.00
X0021:Efna5 UTSW 17 62607400 missense probably damaging 0.98
X0025:Efna5 UTSW 17 62651037 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCAATTCTCCAAAACACAG -3'
(R):5'- TTTCCAACAGATTCCAGAGGGG -3'

Sequencing Primer
(F):5'- TCTCCAGGTACTCACAGA -3'
(R):5'- ATTCCAGAGGGGTGACTACC -3'
Posted On2019-12-20