Incidental Mutation 'R7877:Intu'
ID608480
Institutional Source Beutler Lab
Gene Symbol Intu
Ensembl Gene ENSMUSG00000060798
Gene Nameinturned planar cell polarity protein
SynonymsPdzd6, Pdzk6, 9430087H23Rik, 9230116I04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7877 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location40531286-40704774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40699792 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 905 (V905I)
Ref Sequence ENSEMBL: ENSMUSP00000088725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091186]
AlphaFold Q059U7
Predicted Effect probably benign
Transcript: ENSMUST00000091186
AA Change: V905I

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: V905I

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
PDZ 187 269 2.09e-3 SMART
low complexity region 459 468 N/A INTRINSIC
low complexity region 774 784 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,001,833 C388Y probably damaging Het
1700029J07Rik T A 8: 45,970,399 K92M probably damaging Het
4930522L14Rik G A 5: 109,736,364 H543Y probably damaging Het
Abca1 A T 4: 53,046,135 V1711E possibly damaging Het
Abca3 A T 17: 24,384,023 K531* probably null Het
Adgrf5 A T 17: 43,441,838 D557V possibly damaging Het
Adgrl3 A G 5: 81,694,620 E865G probably benign Het
Adprhl1 T A 8: 13,225,316 R481* probably null Het
Afap1l1 T A 18: 61,746,782 D339V probably damaging Het
Atp9b T A 18: 80,847,197 H309L Het
Baiap3 A G 17: 25,251,138 V122A probably damaging Het
Btg4 T C 9: 51,117,940 S142P probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdca2 T A 14: 67,677,216 T865S probably benign Het
Cdk12 A G 11: 98,240,835 Y964C unknown Het
Cenpo A T 12: 4,214,573 F273Y probably damaging Het
Chac1 T A 2: 119,353,506 D196E probably damaging Het
Clec4n T C 6: 123,232,104 F43L probably benign Het
Colgalt1 T A 8: 71,621,864 C407S probably damaging Het
Csnk1g1 T A 9: 65,999,548 probably null Het
Cyp2b23 T A 7: 26,686,426 E2V probably damaging Het
Cyp51 T A 5: 4,102,929 K91M probably damaging Het
Dnah8 G T 17: 30,663,374 G640V probably benign Het
Dnajc2 G T 5: 21,760,639 S505R possibly damaging Het
Fam124b A T 1: 80,213,336 L110H probably damaging Het
Fam49a A C 12: 12,364,797 Y263S probably benign Het
Fem1b T A 9: 62,796,562 Y472F probably benign Het
Frem1 A G 4: 83,013,812 probably null Het
Gabrg1 A T 5: 70,816,072 D46E probably damaging Het
Gbp4 T C 5: 105,118,295 K627E probably benign Het
Glis1 A G 4: 107,634,703 D776G probably damaging Het
Gm4847 A G 1: 166,640,006 V207A possibly damaging Het
Gm7298 T A 6: 121,782,782 Y1213* probably null Het
Gm8229 T A 14: 44,366,576 L74* probably null Het
Hc A T 2: 34,997,399 Y1364* probably null Het
Hnrnpa2b1 A T 6: 51,466,322 S186R unknown Het
Hrh4 A G 18: 13,022,525 I374V possibly damaging Het
Ighmbp2 A G 19: 3,261,490 L975P probably damaging Het
Large1 T A 8: 73,116,443 R151W probably damaging Het
Limd2 G A 11: 106,159,178 T24M probably benign Het
Med16 A T 10: 79,898,372 C569* probably null Het
Mettl1 T G 10: 127,044,521 V104G possibly damaging Het
Mgat4c A G 10: 102,385,039 T61A probably benign Het
Mrps31 T A 8: 22,424,351 Y238N probably benign Het
Mrs2 T C 13: 24,997,130 E236G probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Noxred1 G A 12: 87,224,987 A136V probably benign Het
Obscn T A 11: 59,133,762 D484V probably damaging Het
Picalm C A 7: 90,130,668 H32Q probably benign Het
Pik3r5 G A 11: 68,490,605 G206R probably damaging Het
Plekhh2 G A 17: 84,575,006 C680Y probably benign Het
Plxna1 A G 6: 89,323,259 F1614S probably damaging Het
Ppip5k1 T C 2: 121,316,754 M1129V probably benign Het
Prp2 C T 6: 132,595,965 T7I unknown Het
Rrbp1 A T 2: 143,947,895 probably benign Het
Sdhaf3 C T 6: 7,038,855 T59M probably benign Het
Slc17a6 T A 7: 51,625,505 I104N probably benign Het
Slc35c1 A T 2: 92,459,057 W48R probably damaging Het
Slc5a4b A T 10: 76,075,052 C317S probably damaging Het
Smim13 G T 13: 41,250,174 probably benign Het
Snrpg T C 6: 86,378,779 V76A probably benign Het
Sntb2 C T 8: 107,011,532 T509I probably benign Het
Sptbn1 T C 11: 30,129,601 D1276G possibly damaging Het
Sptbn2 A G 19: 4,744,262 E1498G possibly damaging Het
Stau1 T A 2: 166,950,867 N393Y possibly damaging Het
Tars2 A T 3: 95,746,089 S500T probably damaging Het
Tbc1d23 A T 16: 57,173,125 D559E probably benign Het
Trav14-2 T C 14: 53,641,051 Y64H possibly damaging Het
Trpm3 A C 19: 22,904,784 E838D probably benign Het
Vmn1r23 G A 6: 57,926,556 A79V probably benign Het
Vmn1r48 G T 6: 90,036,449 N131K probably benign Het
Vmn2r18 A T 5: 151,584,972 M229K probably damaging Het
Zbtb4 G A 11: 69,776,037 R56K probably benign Het
Zfp616 G T 11: 74,084,362 G486W probably damaging Het
Zkscan8 A T 13: 21,520,410 F453Y possibly damaging Het
Other mutations in Intu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Intu APN 3 40664266 missense probably benign 0.12
IGL01386:Intu APN 3 40692587 missense probably damaging 1.00
IGL02645:Intu APN 3 40701272 missense probably benign 0.01
IGL02869:Intu APN 3 40687786 missense probably damaging 1.00
IGL03263:Intu APN 3 40672597 nonsense probably null
H8562:Intu UTSW 3 40692673 missense probably damaging 1.00
PIT4495001:Intu UTSW 3 40697603 missense probably benign 0.07
R0010:Intu UTSW 3 40654272 intron probably benign
R0173:Intu UTSW 3 40675346 critical splice donor site probably null
R0426:Intu UTSW 3 40675305 missense probably damaging 0.97
R1566:Intu UTSW 3 40692578 missense probably damaging 0.99
R1619:Intu UTSW 3 40697631 nonsense probably null
R1658:Intu UTSW 3 40692781 missense probably benign 0.20
R1701:Intu UTSW 3 40664264 missense probably damaging 1.00
R1707:Intu UTSW 3 40540924 missense probably benign 0.03
R1707:Intu UTSW 3 40683501 missense possibly damaging 0.69
R1867:Intu UTSW 3 40664335 missense probably damaging 1.00
R1868:Intu UTSW 3 40664335 missense probably damaging 1.00
R2090:Intu UTSW 3 40683536 missense probably benign 0.00
R2310:Intu UTSW 3 40653813 missense probably benign
R2989:Intu UTSW 3 40692710 missense probably benign 0.11
R4168:Intu UTSW 3 40672623 missense probably benign 0.00
R4530:Intu UTSW 3 40683364 missense possibly damaging 0.95
R5093:Intu UTSW 3 40692917 missense probably benign 0.00
R5541:Intu UTSW 3 40692587 splice site probably null
R5587:Intu UTSW 3 40675308 missense probably damaging 0.99
R5745:Intu UTSW 3 40692972 splice site probably null
R5809:Intu UTSW 3 40679590 missense probably damaging 0.99
R5939:Intu UTSW 3 40692584 missense probably damaging 1.00
R5953:Intu UTSW 3 40679550 missense probably damaging 1.00
R6000:Intu UTSW 3 40654148 nonsense probably null
R6063:Intu UTSW 3 40654094 missense probably damaging 0.97
R6245:Intu UTSW 3 40675326 missense probably damaging 0.98
R6310:Intu UTSW 3 40701291 nonsense probably null
R6353:Intu UTSW 3 40653708 missense probably damaging 1.00
R6451:Intu UTSW 3 40701293 missense possibly damaging 0.94
R6660:Intu UTSW 3 40531951 missense probably benign 0.00
R6848:Intu UTSW 3 40694255 missense probably benign 0.00
R7440:Intu UTSW 3 40697551 missense probably benign 0.04
R7625:Intu UTSW 3 40697599 missense probably benign
R7633:Intu UTSW 3 40654253 missense probably damaging 1.00
R7798:Intu UTSW 3 40691929 missense probably damaging 1.00
R7978:Intu UTSW 3 40697639 missense probably damaging 1.00
R8319:Intu UTSW 3 40653772 missense probably damaging 1.00
R8332:Intu UTSW 3 40675289 missense probably benign 0.35
R8860:Intu UTSW 3 40672732 missense probably benign 0.07
R8926:Intu UTSW 3 40653709 missense possibly damaging 0.69
R8946:Intu UTSW 3 40683359 missense possibly damaging 0.93
Z1177:Intu UTSW 3 40697516 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CTTGTACAGTAACACCATCGATACC -3'
(R):5'- TCTTCTCTTATCTCCACTGGAAGAG -3'

Sequencing Primer
(F):5'- GTAACACCATCGATACCACTTAATAC -3'
(R):5'- TTATCTCCACTGGAAGAGACACAAGG -3'
Posted On2019-12-20