Mutagenetix > Incidental Mutation

Incidental Mutation 'R0147:Dock8'

60850

Institutional Source

Beutler Lab

Gene Symbol

Dock8

Ensembl Gene

ENSMUSG00000052085

Gene Name

dedicator of cytokinesis 8

Synonyms

A130095G14Rik, 5830472H07Rik, 1200017A24Rik

MMRRC Submission

038431-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R0147 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24999529-25202432 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 25119459 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 577 (L577P)

Ref Sequence

ENSEMBL: ENSMUSP00000025831 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025831]

AlphaFold

Q8C147

PDB Structure

Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000025831
AA Change: L577P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: L577P

Domain	Start	End	E-Value	Type
Pfam:DUF3398	71	164	3.9e-25	PFAM
Pfam:DOCK-C2	557	739	6.7e-49	PFAM
low complexity region	786	803	N/A	INTRINSIC
low complexity region	1003	1020	N/A	INTRINSIC
low complexity region	1123	1138	N/A	INTRINSIC
low complexity region	1236	1246	N/A	INTRINSIC
low complexity region	1371	1383	N/A	INTRINSIC
Pfam:DHR-2	1534	2060	5e-210	PFAM

Meta Mutation Damage Score

0.1983

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 94.5%
20x: 86.1%

Validation Efficiency

67% (88/131)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	C	T	18: 12,189,271	R594C	probably damaging	Het
A2m	T	C	6: 121,662,446		probably null	Het
Abtb2	A	G	2: 103,567,135	I137V	probably benign	Het
Ank1	T	A	8: 23,123,977	N1545K	probably damaging	Het
Arl6	T	C	16: 59,618,790		probably benign	Het
Avl9	T	A	6: 56,736,502	D248E	probably benign	Het
Becn1	T	C	11: 101,301,736	E40G	probably damaging	Het
Bod1l	G	T	5: 41,818,697	A1758E	possibly damaging	Het
Btbd16	C	T	7: 130,779,594	T19I	probably damaging	Het
Casc3	T	A	11: 98,822,499	N246K	possibly damaging	Het
Celf1	G	T	2: 91,004,690		probably benign	Het
Chrm3	G	T	13: 9,878,744	N85K	probably damaging	Het
Cluh	T	A	11: 74,665,938	Y935N	probably damaging	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Col6a5	T	C	9: 105,925,794	D1324G	unknown	Het
Ctcfl	T	C	2: 173,118,547	D81G	possibly damaging	Het
D630003M21Rik	C	T	2: 158,203,067		probably benign	Het
Ddx39	C	T	8: 83,722,476	R298C	possibly damaging	Het
Dnmt3b	T	G	2: 153,661,457	N9K	possibly damaging	Het
Drc1	A	T	5: 30,281,489	N13I	possibly damaging	Het
Eml4	T	A	17: 83,421,652	N85K	probably damaging	Het
Epb41l4a	T	C	18: 33,798,800	T581A	probably damaging	Het
Epha3	T	C	16: 63,612,944	D446G	possibly damaging	Het
Fam208a	A	G	14: 27,471,768	D975G	probably benign	Het
Fam209	G	T	2: 172,473,980	G92C	probably damaging	Het
Fam98c	T	A	7: 29,152,721	R340*	probably null	Het
Fbxw10	T	G	11: 62,847,481		probably null	Het
Galr1	A	G	18: 82,405,570	L194P	probably benign	Het
Gar1	T	C	3: 129,829,473	H89R	probably damaging	Het
Gbp4	T	A	5: 105,119,496	Y519F	probably benign	Het
Gm28042	T	A	2: 120,036,463	S196T	probably benign	Het
Grid2	T	C	6: 64,533,587	Y734H	probably benign	Het
Grm6	T	A	11: 50,859,317	I466N	possibly damaging	Het
Hectd3	T	C	4: 116,997,040		probably benign	Het
Hpse2	A	C	19: 42,931,660		probably null	Het
Hspb7	T	C	4: 141,423,991	I148T	probably damaging	Het
Htr1d	C	A	4: 136,443,477	T339K	probably damaging	Het
Ip6k1	T	A	9: 108,045,894	D408E	probably damaging	Het
Irs2	A	T	8: 11,007,568	M288K	probably damaging	Het
Kansl3	A	T	1: 36,353,816	C225S	probably damaging	Het
Knop1	C	A	7: 118,845,838	R301L	probably benign	Het
Lama5	T	C	2: 180,190,406	H1714R	probably benign	Het
Mettl14	G	A	3: 123,371,394	T316I	probably damaging	Het
Mmp15	A	T	8: 95,372,317	N591Y	probably benign	Het
Mprip	T	A	11: 59,737,073	D93E	possibly damaging	Het
Mtmr14	T	A	6: 113,260,666		probably benign	Het
Muc5ac	T	C	7: 141,811,039	S1917P	probably benign	Het
Muc6	C	T	7: 141,651,990	C75Y	probably damaging	Het
Naip1	A	T	13: 100,426,910	H582Q	possibly damaging	Het
Nbeal2	G	A	9: 110,642,143	R264*	probably null	Het
Neb	T	C	2: 52,249,376	K140E	probably damaging	Het
Nfya	A	G	17: 48,398,998	V48A	possibly damaging	Het
Ngf	G	T	3: 102,509,803		probably benign	Het
Nsmce2	T	G	15: 59,378,957	S26A	probably damaging	Het
Olfr1026	T	A	2: 85,924,018	I250N	possibly damaging	Het
Olfr601	T	C	7: 103,358,406	T263A	possibly damaging	Het
Olfr873	T	G	9: 20,301,091	M297R	probably damaging	Het
Pax1	A	G	2: 147,373,734	S424G	probably benign	Het
Pcdhb19	A	T	18: 37,497,182	Q10L	probably benign	Het
Pdcl	T	C	2: 37,352,130	I203V	probably benign	Het
Pknox1	T	A	17: 31,604,790	N379K	probably benign	Het
Plxna1	C	T	6: 89,320,710	A1831T	possibly damaging	Het
Prodh	T	G	16: 18,077,813	Q360P	probably damaging	Het
Pygo2	T	C	3: 89,433,303	V299A	probably damaging	Het
Raf1	C	T	6: 115,632,973	G202S	probably benign	Het
Rgs11	T	A	17: 26,207,459		probably null	Het
Rnf13	A	G	3: 57,802,468	D144G	probably damaging	Het
Rtel1	T	C	2: 181,321,046	C31R	probably damaging	Het
Rubcnl	T	A	14: 75,042,458	I427K	probably damaging	Het
Sec23ip	C	T	7: 128,779,051		probably benign	Het
Slc25a26	T	A	6: 94,592,526		probably null	Het
Slc6a7	A	G	18: 61,002,111		probably benign	Het
Slco6b1	A	T	1: 96,987,837		noncoding transcript	Het
Spata17	A	G	1: 187,112,601	V111A	probably damaging	Het
Spata22	T	A	11: 73,331,153	M1K	probably null	Het
Svep1	C	T	4: 58,116,608	D881N	possibly damaging	Het
Sypl2	T	A	3: 108,219,095	N67I	possibly damaging	Het
Tenm3	T	C	8: 48,236,720	Y1944C	probably damaging	Het
Tm9sf4	G	T	2: 153,195,313	V365L	probably benign	Het
Tmc3	T	C	7: 83,607,742	V401A	probably damaging	Het
Trpm2	C	T	10: 77,925,825	G997D	probably damaging	Het
Unc5b	A	T	10: 60,772,297	S675T	probably damaging	Het
Vmn1r217	A	G	13: 23,113,937	M265T	probably benign	Het
Vps54	T	A	11: 21,300,259	D548E	probably benign	Het
Wdfy3	A	G	5: 101,917,411	V1297A	probably benign	Het
Wdr46	T	A	17: 33,941,023	F70I	probably benign	Het
Zdbf2	C	T	1: 63,304,006	Q515*	probably null	Het
Zfp710	T	A	7: 80,081,973	C299*	probably null	Het

Other mutations in Dock8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
captain_morgan	APN	19	25127712	critical splice donor site	probably benign
primurus	APN	19	25183609	missense	probably damaging	1.00
IGL00737:Dock8	APN	19	25182976	missense	probably benign	0.00
IGL00755:Dock8	APN	19	25051509	missense	probably benign	0.09
IGL00822:Dock8	APN	19	25188409	nonsense	probably null
IGL00838:Dock8	APN	19	25175459	nonsense	probably null
IGL01419:Dock8	APN	19	25119452	missense	probably benign	0.08
IGL01456:Dock8	APN	19	25119499	missense	possibly damaging	0.95
IGL01532:Dock8	APN	19	25169441	missense	probably damaging	0.99
IGL01602:Dock8	APN	19	25089888	splice site	probably benign
IGL01605:Dock8	APN	19	25089888	splice site	probably benign
IGL01753:Dock8	APN	19	25061292	splice site	probably benign
IGL01843:Dock8	APN	19	25089928	missense	probably benign	0.02
IGL02032:Dock8	APN	19	25130405	missense	probably damaging	0.99
IGL02073:Dock8	APN	19	25200986	critical splice acceptor site	probably null
IGL02192:Dock8	APN	19	25078205	critical splice donor site	probably null
IGL02402:Dock8	APN	19	25078145	missense	probably benign	0.25
IGL02529:Dock8	APN	19	25100926	nonsense	probably null
IGL02728:Dock8	APN	19	25132220	missense	probably benign
IGL02739:Dock8	APN	19	25188488	missense	probably damaging	1.00
IGL03037:Dock8	APN	19	25086181	missense	probably benign	0.02
IGL03104:Dock8	APN	19	25201020	nonsense	probably null
IGL03137:Dock8	APN	19	25155948	missense	probably benign	0.19
IGL03365:Dock8	APN	19	25099684	missense	possibly damaging	0.70
Defenseless	UTSW	19	25051563	missense	probably benign	0.00
Guardate	UTSW	19	25149831	missense	probably benign
hillock	UTSW	19	25174333	critical splice donor site	probably null
Molehill	UTSW	19	25130461	missense	probably damaging	1.00
Pap	UTSW	19	25122441	missense	probably benign	0.31
Papilla	UTSW	19	25078084	nonsense	probably null
snowdrop	UTSW	19	25184941	critical splice donor site	probably null
warts_and_all	UTSW	19	25169501	critical splice donor site	probably null
R0021:Dock8	UTSW	19	25163047	missense	probably benign	0.01
R0148:Dock8	UTSW	19	25119459	missense	probably benign	0.00
R0294:Dock8	UTSW	19	25188350	missense	probably damaging	1.00
R0537:Dock8	UTSW	19	25171577	missense	probably benign	0.08
R0630:Dock8	UTSW	19	25061160	missense	probably benign	0.10
R1163:Dock8	UTSW	19	25051503	missense	probably benign
R1164:Dock8	UTSW	19	25090027	missense	probably benign	0.44
R1471:Dock8	UTSW	19	25201036	missense	possibly damaging	0.74
R1477:Dock8	UTSW	19	25095550	missense	possibly damaging	0.95
R1633:Dock8	UTSW	19	25051563	missense	probably benign	0.00
R1803:Dock8	UTSW	19	25132235	missense	probably benign	0.00
R1822:Dock8	UTSW	19	25161058	missense	probably benign	0.31
R1852:Dock8	UTSW	19	25127128	missense	probably benign	0.45
R1916:Dock8	UTSW	19	25061157	missense	probably benign	0.02
R1984:Dock8	UTSW	19	25121181	missense	probably null
R2311:Dock8	UTSW	19	25183004	missense	possibly damaging	0.93
R2341:Dock8	UTSW	19	25200393	missense	probably damaging	0.99
R2483:Dock8	UTSW	19	25079877	missense	probably benign
R3116:Dock8	UTSW	19	25188494	missense	probably benign	0.00
R3157:Dock8	UTSW	19	25149831	missense	probably benign
R3623:Dock8	UTSW	19	25079877	missense	probably benign
R3624:Dock8	UTSW	19	25079877	missense	probably benign
R3800:Dock8	UTSW	19	25164352	missense	probably benign	0.08
R3844:Dock8	UTSW	19	25065430	nonsense	probably null
R3895:Dock8	UTSW	19	25051501	missense	probably benign	0.31
R3901:Dock8	UTSW	19	25100905	missense	possibly damaging	0.69
R3959:Dock8	UTSW	19	25184941	critical splice donor site	probably null
R4428:Dock8	UTSW	19	25200499	missense	probably damaging	0.98
R4428:Dock8	UTSW	19	25065390	missense	probably benign	0.00
R4429:Dock8	UTSW	19	25065390	missense	probably benign	0.00
R4431:Dock8	UTSW	19	25065390	missense	probably benign	0.00
R4545:Dock8	UTSW	19	25188358	missense	probably damaging	1.00
R4839:Dock8	UTSW	19	25169494	missense	probably benign	0.00
R4897:Dock8	UTSW	19	25181637	missense	probably benign	0.00
R4939:Dock8	UTSW	19	25122400	missense	probably damaging	1.00
R4995:Dock8	UTSW	19	25158383	missense	probably benign	0.02
R5035:Dock8	UTSW	19	25086207	missense	probably damaging	0.99
R5294:Dock8	UTSW	19	25061153	missense	probably benign	0.01
R5324:Dock8	UTSW	19	25163094	missense	probably benign	0.17
R5478:Dock8	UTSW	19	25079822	missense	probably benign
R5704:Dock8	UTSW	19	25174222	missense	probably damaging	1.00
R5724:Dock8	UTSW	19	25122421	missense	probably damaging	1.00
R5745:Dock8	UTSW	19	25130397	missense	probably benign	0.02
R5864:Dock8	UTSW	19	25061220	missense	probably damaging	0.99
R5870:Dock8	UTSW	19	25132126	missense	probably benign
R5893:Dock8	UTSW	19	25122447	missense	probably damaging	1.00
R5954:Dock8	UTSW	19	25171619	missense	probably damaging	1.00
R6087:Dock8	UTSW	19	25161074	missense	probably benign	0.00
R6223:Dock8	UTSW	19	25161052	missense	probably benign	0.00
R6391:Dock8	UTSW	19	25095550	missense	possibly damaging	0.95
R6759:Dock8	UTSW	19	25127484	missense	probably damaging	0.99
R6786:Dock8	UTSW	19	25183022	missense	possibly damaging	0.49
R6794:Dock8	UTSW	19	25122441	missense	probably benign	0.31
R6818:Dock8	UTSW	19	25169501	critical splice donor site	probably null
R6885:Dock8	UTSW	19	25147378	missense	possibly damaging	0.95
R6908:Dock8	UTSW	19	25188382	missense	probably damaging	1.00
R6923:Dock8	UTSW	19	25095606	missense	probably benign
R7001:Dock8	UTSW	19	25099677	missense	probably benign
R7141:Dock8	UTSW	19	25181620	missense	probably null	0.75
R7203:Dock8	UTSW	19	25181563	missense	probably damaging	1.00
R7257:Dock8	UTSW	19	25127085	missense	probably benign	0.08
R7296:Dock8	UTSW	19	25184881	missense	probably benign	0.00
R7538:Dock8	UTSW	19	25158418	missense	probably damaging	1.00
R7555:Dock8	UTSW	19	25175400	missense	probably damaging	0.99
R7641:Dock8	UTSW	19	25174333	critical splice donor site	probably null
R7764:Dock8	UTSW	19	25097535	missense	probably benign
R7859:Dock8	UTSW	19	25183570	missense	probably damaging	1.00
R7864:Dock8	UTSW	19	25163500	missense	possibly damaging	0.95
R8090:Dock8	UTSW	19	25154242	missense	probably damaging	1.00
R8160:Dock8	UTSW	19	25147347	missense	probably damaging	1.00
R8287:Dock8	UTSW	19	25130461	missense	probably damaging	1.00
R8295:Dock8	UTSW	19	25123236	missense	probably benign	0.04
R8443:Dock8	UTSW	19	25155917	missense	probably benign	0.04
R8537:Dock8	UTSW	19	25130506	missense	probably benign	0.00
R8673:Dock8	UTSW	19	25183503	missense	probably damaging	0.96
R8709:Dock8	UTSW	19	25078084	nonsense	probably null
R8834:Dock8	UTSW	19	25163470	missense	probably benign	0.16
R8991:Dock8	UTSW	19	25188367	missense	possibly damaging	0.82
R9292:Dock8	UTSW	19	25183631	splice site	probably benign
R9509:Dock8	UTSW	19	25095621	missense	probably benign	0.00
R9526:Dock8	UTSW	19	25188375	missense	probably benign	0.10
R9622:Dock8	UTSW	19	25121181	missense	probably null
R9634:Dock8	UTSW	19	25192221	missense	probably damaging	1.00
R9654:Dock8	UTSW	19	25147346	missense	probably damaging	1.00
R9670:Dock8	UTSW	19	25171562	missense	probably null	0.01
R9699:Dock8	UTSW	19	25156024	critical splice donor site	probably null
R9726:Dock8	UTSW	19	25177010	missense	probably damaging	0.97
R9765:Dock8	UTSW	19	25169468	missense	possibly damaging	0.94
X0027:Dock8	UTSW	19	25161129	missense	probably benign
Z1177:Dock8	UTSW	19	25132123	missense	probably benign	0.05
Z1177:Dock8	UTSW	19	25155972	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- AGTCACCAGCTTGTAGTGCAGATTC -3'
(R):5'- GGACGTACTCTGTATGCTGAGCAAC -3'

Sequencing Primer
(F):5'- CAGCTTGTAGTGCAGATTCTGAAC -3'
(R):5'- CTGTATGCTGAGCAACTCTTG -3'

Posted On

2013-07-24