Incidental Mutation 'R7877:Clec4n'
ID608500
Institutional Source Beutler Lab
Gene Symbol Clec4n
Ensembl Gene ENSMUSG00000023349
Gene NameC-type lectin domain family 4, member n
Synonymsdectin-2, Clecsf10, Nkcl
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7877 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location123229843-123247021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123232104 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 43 (F43L)
Ref Sequence ENSEMBL: ENSMUSP00000024118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024118] [ENSMUST00000112554] [ENSMUST00000117130] [ENSMUST00000151714] [ENSMUST00000205129]
Predicted Effect probably benign
Transcript: ENSMUST00000024118
AA Change: F43L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000024118
Gene: ENSMUSG00000023349
AA Change: F43L

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
CLECT 79 203 5.89e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112554
SMART Domains Protein: ENSMUSP00000108173
Gene: ENSMUSG00000023349

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
CLECT 45 169 5.89e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117130
AA Change: F13L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113733
Gene: ENSMUSG00000023349
AA Change: F13L

DomainStartEndE-ValueType
CLECT 49 173 5.89e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151714
SMART Domains Protein: ENSMUSP00000120043
Gene: ENSMUSG00000023349

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205129
AA Change: F43L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000145023
Gene: ENSMUSG00000023349
AA Change: F43L

DomainStartEndE-ValueType
Blast:CLECT 26 72 3e-13 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane receptor with an extracellular C-type lectin-like domain fold. The extracellular portion binds structures with a high mannose content and has been shown to recognize several pathogens, including C. elegans, S. cerevisiae, M. tuberculosis, C. neoformans, and house dust mite. When stimulated, the encoded protein initiates signalling through the CARD9-Bcl10-Malt1 pathway, leading to the induction of cytokines. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele have defective responses to Candida albicans. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,001,833 C388Y probably damaging Het
1700029J07Rik T A 8: 45,970,399 K92M probably damaging Het
4930522L14Rik G A 5: 109,736,364 H543Y probably damaging Het
Abca1 A T 4: 53,046,135 V1711E possibly damaging Het
Abca3 A T 17: 24,384,023 K531* probably null Het
Adgrf5 A T 17: 43,441,838 D557V possibly damaging Het
Adgrl3 A G 5: 81,694,620 E865G probably benign Het
Adprhl1 T A 8: 13,225,316 R481* probably null Het
Afap1l1 T A 18: 61,746,782 D339V probably damaging Het
Atp9b T A 18: 80,847,197 H309L Het
Baiap3 A G 17: 25,251,138 V122A probably damaging Het
Btg4 T C 9: 51,117,940 S142P probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdca2 T A 14: 67,677,216 T865S probably benign Het
Cdk12 A G 11: 98,240,835 Y964C unknown Het
Cenpo A T 12: 4,214,573 F273Y probably damaging Het
Chac1 T A 2: 119,353,506 D196E probably damaging Het
Colgalt1 T A 8: 71,621,864 C407S probably damaging Het
Csnk1g1 T A 9: 65,999,548 probably null Het
Cyp2b23 T A 7: 26,686,426 E2V probably damaging Het
Cyp51 T A 5: 4,102,929 K91M probably damaging Het
Dnah8 G T 17: 30,663,374 G640V probably benign Het
Dnajc2 G T 5: 21,760,639 S505R possibly damaging Het
Fam124b A T 1: 80,213,336 L110H probably damaging Het
Fam49a A C 12: 12,364,797 Y263S probably benign Het
Fem1b T A 9: 62,796,562 Y472F probably benign Het
Frem1 A G 4: 83,013,812 probably null Het
Gabrg1 A T 5: 70,816,072 D46E probably damaging Het
Gbp4 T C 5: 105,118,295 K627E probably benign Het
Glis1 A G 4: 107,634,703 D776G probably damaging Het
Gm4847 A G 1: 166,640,006 V207A possibly damaging Het
Gm7298 T A 6: 121,782,782 Y1213* probably null Het
Gm8229 T A 14: 44,366,576 L74* probably null Het
Hc A T 2: 34,997,399 Y1364* probably null Het
Hnrnpa2b1 A T 6: 51,466,322 S186R unknown Het
Hrh4 A G 18: 13,022,525 I374V possibly damaging Het
Ighmbp2 A G 19: 3,261,490 L975P probably damaging Het
Intu G A 3: 40,699,792 V905I probably benign Het
Large1 T A 8: 73,116,443 R151W probably damaging Het
Limd2 G A 11: 106,159,178 T24M probably benign Het
Med16 A T 10: 79,898,372 C569* probably null Het
Mettl1 T G 10: 127,044,521 V104G possibly damaging Het
Mgat4c A G 10: 102,385,039 T61A probably benign Het
Mrps31 T A 8: 22,424,351 Y238N probably benign Het
Mrs2 T C 13: 24,997,130 E236G probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Noxred1 G A 12: 87,224,987 A136V probably benign Het
Obscn T A 11: 59,133,762 D484V probably damaging Het
Picalm C A 7: 90,130,668 H32Q probably benign Het
Pik3r5 G A 11: 68,490,605 G206R probably damaging Het
Plekhh2 G A 17: 84,575,006 C680Y probably benign Het
Plxna1 A G 6: 89,323,259 F1614S probably damaging Het
Ppip5k1 T C 2: 121,316,754 M1129V probably benign Het
Prp2 C T 6: 132,595,965 T7I unknown Het
Rrbp1 A T 2: 143,947,895 probably benign Het
Sdhaf3 C T 6: 7,038,855 T59M probably benign Het
Slc17a6 T A 7: 51,625,505 I104N probably benign Het
Slc35c1 A T 2: 92,459,057 W48R probably damaging Het
Slc5a4b A T 10: 76,075,052 C317S probably damaging Het
Smim13 G T 13: 41,250,174 probably benign Het
Snrpg T C 6: 86,378,779 V76A probably benign Het
Sntb2 C T 8: 107,011,532 T509I probably benign Het
Sptbn1 T C 11: 30,129,601 D1276G possibly damaging Het
Sptbn2 A G 19: 4,744,262 E1498G possibly damaging Het
Stau1 T A 2: 166,950,867 N393Y possibly damaging Het
Tars2 A T 3: 95,746,089 S500T probably damaging Het
Tbc1d23 A T 16: 57,173,125 D559E probably benign Het
Trav14-2 T C 14: 53,641,051 Y64H possibly damaging Het
Trpm3 A C 19: 22,904,784 E838D probably benign Het
Vmn1r23 G A 6: 57,926,556 A79V probably benign Het
Vmn1r48 G T 6: 90,036,449 N131K probably benign Het
Vmn2r18 A T 5: 151,584,972 M229K probably damaging Het
Zbtb4 G A 11: 69,776,037 R56K probably benign Het
Zfp616 G T 11: 74,084,362 G486W probably damaging Het
Zkscan8 A T 13: 21,520,410 F453Y possibly damaging Het
Other mutations in Clec4n
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Clec4n APN 6 123244474 intron probably benign
IGL02248:Clec4n APN 6 123230568 missense probably damaging 0.99
IGL03181:Clec4n APN 6 123230515 missense possibly damaging 0.90
IGL03293:Clec4n APN 6 123232146 missense probably benign 0.10
P4717OSA:Clec4n UTSW 6 123244540 missense probably damaging 0.97
P4748:Clec4n UTSW 6 123244540 missense probably damaging 0.97
R1137:Clec4n UTSW 6 123246567 missense possibly damaging 0.80
R1445:Clec4n UTSW 6 123235516 missense probably benign 0.01
R1538:Clec4n UTSW 6 123230033 missense possibly damaging 0.66
R1804:Clec4n UTSW 6 123230022 missense possibly damaging 0.46
R1960:Clec4n UTSW 6 123230546 missense probably damaging 0.99
R2046:Clec4n UTSW 6 123246504 missense probably benign 0.00
R4097:Clec4n UTSW 6 123230741 missense possibly damaging 0.66
R4657:Clec4n UTSW 6 123232196 critical splice donor site probably null
R4967:Clec4n UTSW 6 123232107 missense probably benign 0.41
R5471:Clec4n UTSW 6 123232186 missense probably benign 0.06
R6703:Clec4n UTSW 6 123235594 missense probably null 1.00
R7411:Clec4n UTSW 6 123232186 missense probably benign 0.06
R7960:Clec4n UTSW 6 123232104 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACTTGTGGCAGTTCCCTGATG -3'
(R):5'- GAATGCTTGATAGTTTCCAAGTCG -3'

Sequencing Primer
(F):5'- CAGGGGTTTGTTATTAATTCATGAAG -3'
(R):5'- TCCAAGTCGAAACATCTCTCTC -3'
Posted On2019-12-20