Incidental Mutation 'R7877:Muc5ac'
ID608506
Institutional Source Beutler Lab
Gene Symbol Muc5ac
Ensembl Gene ENSMUSG00000037974
Gene Namemucin 5, subtypes A and C, tracheobronchial/gastric
SynonymsMGM, 2210005L13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7877 (G1)
Quality Score205.009
Status Not validated
Chromosome7
Chromosomal Location141788972-141819231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 141809303 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Alanine at position 2117 (G2117A)
Ref Sequence ENSEMBL: ENSMUSP00000122353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041924] [ENSMUST00000155534] [ENSMUST00000163321]
Predicted Effect probably benign
Transcript: ENSMUST00000041924
SMART Domains Protein: ENSMUSP00000039699
Gene: ENSMUSG00000037974

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 1.6e-14 PFAM
VWC 395 462 8.6e-18 SMART
VWD 421 585 1.55e-33 SMART
C8 622 696 8.42e-36 SMART
Pfam:TIL 702 759 6.1e-9 PFAM
VWC 761 825 6.75e-1 SMART
VWC 863 905 4.06e-1 SMART
VWD 890 1050 1.51e-45 SMART
C8 1086 1160 2.78e-36 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1333 1366 N/A INTRINSIC
low complexity region 1371 1387 N/A INTRINSIC
Pfam:Mucin2_WxxW 1394 1482 2.3e-25 PFAM
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1536 1563 N/A INTRINSIC
low complexity region 1578 1595 N/A INTRINSIC
Pfam:Mucin2_WxxW 1604 1692 2.2e-27 PFAM
Pfam:Mucin2_WxxW 1765 1857 8.6e-27 PFAM
low complexity region 1875 1895 N/A INTRINSIC
low complexity region 1949 1968 N/A INTRINSIC
VWD 2030 2199 4.17e-48 SMART
C8 2242 2311 3.95e-9 SMART
VWC 2376 2439 1.04e-11 SMART
VWC 2479 2543 9.31e-5 SMART
CT 2625 2711 3.43e-32 SMART
low complexity region 2720 2733 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000155534
AA Change: G2117A
SMART Domains Protein: ENSMUSP00000122353
Gene: ENSMUSG00000037974
AA Change: G2117A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 9.6e-15 PFAM
VWC 395 437 3.54e-1 SMART
VWD 422 586 2.35e-33 SMART
C8 623 697 8.42e-36 SMART
Pfam:TIL 703 760 3.6e-9 PFAM
VWC 762 826 6.75e-1 SMART
VWC 864 906 4.06e-1 SMART
VWD 891 1051 1.51e-45 SMART
C8 1087 1161 2.78e-36 SMART
low complexity region 1316 1331 N/A INTRINSIC
low complexity region 1334 1367 N/A INTRINSIC
low complexity region 1372 1388 N/A INTRINSIC
Pfam:Mucin2_WxxW 1395 1483 1.3e-25 PFAM
low complexity region 1522 1533 N/A INTRINSIC
low complexity region 1537 1564 N/A INTRINSIC
low complexity region 1579 1596 N/A INTRINSIC
Pfam:Mucin2_WxxW 1605 1693 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163321
SMART Domains Protein: ENSMUSP00000131681
Gene: ENSMUSG00000037974

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 7.9e-15 PFAM
VWC 395 462 8.6e-18 SMART
VWD 421 585 1.55e-33 SMART
C8 622 696 8.42e-36 SMART
Pfam:TIL 702 759 1.9e-9 PFAM
VWC 761 825 6.75e-1 SMART
VWC 863 905 4.06e-1 SMART
VWD 890 1050 1.51e-45 SMART
C8 1086 1160 2.78e-36 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1333 1366 N/A INTRINSIC
low complexity region 1371 1387 N/A INTRINSIC
Pfam:Mucin2_WxxW 1394 1481 1.1e-23 PFAM
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1536 1563 N/A INTRINSIC
low complexity region 1578 1595 N/A INTRINSIC
Pfam:Mucin2_WxxW 1604 1691 1.1e-25 PFAM
Pfam:Mucin2_WxxW 1765 1856 6.3e-24 PFAM
low complexity region 1875 1895 N/A INTRINSIC
low complexity region 1949 1968 N/A INTRINSIC
VWD 2030 2199 4.17e-48 SMART
C8 2242 2311 3.95e-9 SMART
VWC 2376 2439 1.04e-11 SMART
VWC 2479 2543 9.31e-5 SMART
CT 2625 2711 3.43e-32 SMART
low complexity region 2720 2733 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to T. muris infection with persistent worm burden, goblet cell hyperplasia, and increased serum IFN-gamma despite a normal TH2-type immune response. A portion of mice show corneal opacity and poor tear quality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,001,833 C388Y probably damaging Het
1700029J07Rik T A 8: 45,970,399 K92M probably damaging Het
4930522L14Rik G A 5: 109,736,364 H543Y probably damaging Het
Abca1 A T 4: 53,046,135 V1711E possibly damaging Het
Abca3 A T 17: 24,384,023 K531* probably null Het
Adgrf5 A T 17: 43,441,838 D557V possibly damaging Het
Adgrl3 A G 5: 81,694,620 E865G probably benign Het
Adprhl1 T A 8: 13,225,316 R481* probably null Het
Afap1l1 T A 18: 61,746,782 D339V probably damaging Het
Atp9b T A 18: 80,847,197 H309L Het
Baiap3 A G 17: 25,251,138 V122A probably damaging Het
Btg4 T C 9: 51,117,940 S142P probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdca2 T A 14: 67,677,216 T865S probably benign Het
Cdk12 A G 11: 98,240,835 Y964C unknown Het
Cenpo A T 12: 4,214,573 F273Y probably damaging Het
Chac1 T A 2: 119,353,506 D196E probably damaging Het
Clec4n T C 6: 123,232,104 F43L probably benign Het
Colgalt1 T A 8: 71,621,864 C407S probably damaging Het
Csnk1g1 T A 9: 65,999,548 probably null Het
Cyp2b23 T A 7: 26,686,426 E2V probably damaging Het
Cyp51 T A 5: 4,102,929 K91M probably damaging Het
Dnah8 G T 17: 30,663,374 G640V probably benign Het
Dnajc2 G T 5: 21,760,639 S505R possibly damaging Het
Fam124b A T 1: 80,213,336 L110H probably damaging Het
Fam49a A C 12: 12,364,797 Y263S probably benign Het
Fem1b T A 9: 62,796,562 Y472F probably benign Het
Frem1 A G 4: 83,013,812 probably null Het
Gabrg1 A T 5: 70,816,072 D46E probably damaging Het
Gbp4 T C 5: 105,118,295 K627E probably benign Het
Glis1 A G 4: 107,634,703 D776G probably damaging Het
Gm4847 A G 1: 166,640,006 V207A possibly damaging Het
Gm7298 T A 6: 121,782,782 Y1213* probably null Het
Gm8229 T A 14: 44,366,576 L74* probably null Het
Hc A T 2: 34,997,399 Y1364* probably null Het
Hnrnpa2b1 A T 6: 51,466,322 S186R unknown Het
Hrh4 A G 18: 13,022,525 I374V possibly damaging Het
Ighmbp2 A G 19: 3,261,490 L975P probably damaging Het
Intu G A 3: 40,699,792 V905I probably benign Het
Large1 T A 8: 73,116,443 R151W probably damaging Het
Limd2 G A 11: 106,159,178 T24M probably benign Het
Med16 A T 10: 79,898,372 C569* probably null Het
Mettl1 T G 10: 127,044,521 V104G possibly damaging Het
Mgat4c A G 10: 102,385,039 T61A probably benign Het
Mrps31 T A 8: 22,424,351 Y238N probably benign Het
Mrs2 T C 13: 24,997,130 E236G probably damaging Het
Noxred1 G A 12: 87,224,987 A136V probably benign Het
Obscn T A 11: 59,133,762 D484V probably damaging Het
Picalm C A 7: 90,130,668 H32Q probably benign Het
Pik3r5 G A 11: 68,490,605 G206R probably damaging Het
Plekhh2 G A 17: 84,575,006 C680Y probably benign Het
Plxna1 A G 6: 89,323,259 F1614S probably damaging Het
Ppip5k1 T C 2: 121,316,754 M1129V probably benign Het
Prp2 C T 6: 132,595,965 T7I unknown Het
Rrbp1 A T 2: 143,947,895 probably benign Het
Sdhaf3 C T 6: 7,038,855 T59M probably benign Het
Slc17a6 T A 7: 51,625,505 I104N probably benign Het
Slc35c1 A T 2: 92,459,057 W48R probably damaging Het
Slc5a4b A T 10: 76,075,052 C317S probably damaging Het
Smim13 G T 13: 41,250,174 probably benign Het
Snrpg T C 6: 86,378,779 V76A probably benign Het
Sntb2 C T 8: 107,011,532 T509I probably benign Het
Sptbn1 T C 11: 30,129,601 D1276G possibly damaging Het
Sptbn2 A G 19: 4,744,262 E1498G possibly damaging Het
Stau1 T A 2: 166,950,867 N393Y possibly damaging Het
Tars2 A T 3: 95,746,089 S500T probably damaging Het
Tbc1d23 A T 16: 57,173,125 D559E probably benign Het
Trav14-2 T C 14: 53,641,051 Y64H possibly damaging Het
Trpm3 A C 19: 22,904,784 E838D probably benign Het
Vmn1r23 G A 6: 57,926,556 A79V probably benign Het
Vmn1r48 G T 6: 90,036,449 N131K probably benign Het
Vmn2r18 A T 5: 151,584,972 M229K probably damaging Het
Zbtb4 G A 11: 69,776,037 R56K probably benign Het
Zfp616 G T 11: 74,084,362 G486W probably damaging Het
Zkscan8 A T 13: 21,520,410 F453Y possibly damaging Het
Other mutations in Muc5ac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Muc5ac APN 7 141812703 missense possibly damaging 0.93
IGL01064:Muc5ac APN 7 141807473 missense probably benign 0.12
IGL01155:Muc5ac APN 7 141806943 splice site probably benign
IGL01452:Muc5ac APN 7 141817555 missense probably benign 0.00
IGL01590:Muc5ac APN 7 141798893 missense probably benign 0.02
IGL02104:Muc5ac APN 7 141811078 missense probably damaging 0.98
IGL02152:Muc5ac APN 7 141800177 missense possibly damaging 0.86
IGL02153:Muc5ac APN 7 141818800 nonsense probably null
IGL02178:Muc5ac APN 7 141805447 splice site probably benign
IGL02403:Muc5ac APN 7 141803450 missense possibly damaging 0.71
IGL02576:Muc5ac APN 7 141817044 missense probably benign 0.01
IGL02665:Muc5ac APN 7 141791086 missense possibly damaging 0.71
IGL02704:Muc5ac APN 7 141795263 missense possibly damaging 0.71
IGL02808:Muc5ac APN 7 141805775 missense possibly damaging 0.72
IGL03283:Muc5ac APN 7 141813781 missense probably benign 0.34
IGL03384:Muc5ac APN 7 141812403 missense possibly damaging 0.71
IGL03046:Muc5ac UTSW 7 141795213 missense probably benign 0.27
PIT4515001:Muc5ac UTSW 7 141807416 missense probably damaging 0.99
R0092:Muc5ac UTSW 7 141818630 missense possibly damaging 0.72
R0145:Muc5ac UTSW 7 141795275 missense possibly damaging 0.71
R0147:Muc5ac UTSW 7 141811039 missense probably benign 0.08
R0363:Muc5ac UTSW 7 141800960 missense probably benign 0.01
R0384:Muc5ac UTSW 7 141812251 missense possibly damaging 0.71
R0440:Muc5ac UTSW 7 141792034 nonsense probably null
R0583:Muc5ac UTSW 7 141807608 missense probably damaging 0.99
R0616:Muc5ac UTSW 7 141796244 missense probably benign 0.02
R0682:Muc5ac UTSW 7 141805669 missense possibly damaging 0.53
R0685:Muc5ac UTSW 7 141807709 missense probably benign 0.03
R0883:Muc5ac UTSW 7 141796265 missense possibly damaging 0.71
R0924:Muc5ac UTSW 7 141807515 missense possibly damaging 0.68
R1300:Muc5ac UTSW 7 141816929 missense possibly damaging 0.73
R1315:Muc5ac UTSW 7 141807323 missense probably damaging 0.99
R1354:Muc5ac UTSW 7 141807377 missense probably damaging 0.99
R1484:Muc5ac UTSW 7 141813892 splice site probably null
R1599:Muc5ac UTSW 7 141798903 missense possibly damaging 0.52
R1758:Muc5ac UTSW 7 141801531 missense possibly damaging 0.86
R1837:Muc5ac UTSW 7 141807086 missense probably benign 0.00
R1911:Muc5ac UTSW 7 141796304 missense probably benign 0.18
R1922:Muc5ac UTSW 7 141793689 missense probably benign 0.03
R1966:Muc5ac UTSW 7 141803376 missense possibly damaging 0.92
R1994:Muc5ac UTSW 7 141813152 missense possibly damaging 0.93
R2056:Muc5ac UTSW 7 141792035 missense probably benign 0.01
R2126:Muc5ac UTSW 7 141810742 missense possibly damaging 0.84
R2170:Muc5ac UTSW 7 141812347 missense possibly damaging 0.93
R2258:Muc5ac UTSW 7 141791008 missense probably benign 0.41
R2259:Muc5ac UTSW 7 141791008 missense probably benign 0.41
R2293:Muc5ac UTSW 7 141807199 missense probably damaging 0.99
R2435:Muc5ac UTSW 7 141818104 missense possibly damaging 0.53
R2895:Muc5ac UTSW 7 141791140 missense possibly damaging 0.92
R2910:Muc5ac UTSW 7 141807641 missense probably damaging 0.99
R3154:Muc5ac UTSW 7 141792736 splice site probably null
R3762:Muc5ac UTSW 7 141807475 missense possibly damaging 0.53
R3791:Muc5ac UTSW 7 141798501 missense probably benign 0.32
R3806:Muc5ac UTSW 7 141813734 missense possibly damaging 0.91
R3825:Muc5ac UTSW 7 141814723 missense possibly damaging 0.92
R3888:Muc5ac UTSW 7 141791224 missense possibly damaging 0.51
R3929:Muc5ac UTSW 7 141802892 missense probably benign
R3981:Muc5ac UTSW 7 141813775 missense possibly damaging 0.86
R4034:Muc5ac UTSW 7 141799844 critical splice donor site probably null
R4043:Muc5ac UTSW 7 141807478 missense possibly damaging 0.53
R4061:Muc5ac UTSW 7 141811130 missense possibly damaging 0.85
R4106:Muc5ac UTSW 7 141802835 missense possibly damaging 0.86
R4206:Muc5ac UTSW 7 141817110 missense possibly damaging 0.73
R4613:Muc5ac UTSW 7 141791103 missense possibly damaging 0.93
R4719:Muc5ac UTSW 7 141789763 missense possibly damaging 0.83
R4751:Muc5ac UTSW 7 141817601 missense probably benign 0.00
R4789:Muc5ac UTSW 7 141798882 missense possibly damaging 0.86
R4928:Muc5ac UTSW 7 141817902 nonsense probably null
R4971:Muc5ac UTSW 7 141816278 missense possibly damaging 0.68
R4982:Muc5ac UTSW 7 141809456 intron probably benign
R5088:Muc5ac UTSW 7 141796319 missense possibly damaging 0.53
R5141:Muc5ac UTSW 7 141814742 missense possibly damaging 0.72
R5224:Muc5ac UTSW 7 141793971 missense probably benign 0.32
R5366:Muc5ac UTSW 7 141807550 missense probably benign 0.01
R5497:Muc5ac UTSW 7 141807643 missense probably damaging 0.99
R5507:Muc5ac UTSW 7 141807832 missense possibly damaging 0.72
R5643:Muc5ac UTSW 7 141793715 critical splice donor site probably null
R5811:Muc5ac UTSW 7 141798984 missense possibly damaging 0.51
R5946:Muc5ac UTSW 7 141817907 missense possibly damaging 0.73
R5970:Muc5ac UTSW 7 141790669 nonsense probably null
R5977:Muc5ac UTSW 7 141796367 missense possibly damaging 0.73
R6051:Muc5ac UTSW 7 141811857 missense possibly damaging 0.53
R6126:Muc5ac UTSW 7 141801232 missense possibly damaging 0.71
R6159:Muc5ac UTSW 7 141815586 missense possibly damaging 0.53
R6256:Muc5ac UTSW 7 141789795 missense possibly damaging 0.53
R6283:Muc5ac UTSW 7 141816864 nonsense probably null
R6341:Muc5ac UTSW 7 141801492 missense probably damaging 0.99
R6356:Muc5ac UTSW 7 141812679 missense probably benign 0.05
R6481:Muc5ac UTSW 7 141809071 intron probably benign
R6483:Muc5ac UTSW 7 141802854 missense probably benign 0.18
R6627:Muc5ac UTSW 7 141808690 intron probably benign
R6636:Muc5ac UTSW 7 141818605 missense possibly damaging 0.86
R6637:Muc5ac UTSW 7 141818605 missense possibly damaging 0.86
R6656:Muc5ac UTSW 7 141803328 missense probably damaging 0.98
R6721:Muc5ac UTSW 7 141798992 missense possibly damaging 0.71
R6794:Muc5ac UTSW 7 141809552 intron probably benign
R6844:Muc5ac UTSW 7 141809744 intron probably benign
R6847:Muc5ac UTSW 7 141809744 intron probably benign
R6852:Muc5ac UTSW 7 141816907 missense probably benign 0.03
R6862:Muc5ac UTSW 7 141809744 intron probably benign
R6863:Muc5ac UTSW 7 141809744 intron probably benign
R6864:Muc5ac UTSW 7 141809744 intron probably benign
R6865:Muc5ac UTSW 7 141809744 intron probably benign
R6874:Muc5ac UTSW 7 141809744 intron probably benign
R6875:Muc5ac UTSW 7 141809744 intron probably benign
R6876:Muc5ac UTSW 7 141809744 intron probably benign
R6877:Muc5ac UTSW 7 141809744 intron probably benign
R6889:Muc5ac UTSW 7 141809744 intron probably benign
R6920:Muc5ac UTSW 7 141793298 missense possibly damaging 0.86
R6998:Muc5ac UTSW 7 141818714 missense possibly damaging 0.92
R7017:Muc5ac UTSW 7 141809687 intron probably benign
R7091:Muc5ac UTSW 7 141809687 intron probably benign
R7092:Muc5ac UTSW 7 141809648 intron probably benign
R7092:Muc5ac UTSW 7 141809687 intron probably benign
R7110:Muc5ac UTSW 7 141799822 missense possibly damaging 0.95
R7117:Muc5ac UTSW 7 141813822 nonsense probably null
R7238:Muc5ac UTSW 7 141809517 missense unknown
R7238:Muc5ac UTSW 7 141809687 intron probably benign
R7396:Muc5ac UTSW 7 141808415 missense unknown
R7456:Muc5ac UTSW 7 141793167 missense probably benign 0.32
R7477:Muc5ac UTSW 7 141816282 missense possibly damaging 0.72
R7530:Muc5ac UTSW 7 141813799 missense possibly damaging 0.51
R7545:Muc5ac UTSW 7 141808668 missense unknown
R7604:Muc5ac UTSW 7 141809709 missense unknown
R7635:Muc5ac UTSW 7 141805676 missense probably damaging 0.98
R7635:Muc5ac UTSW 7 141805753 missense possibly damaging 0.53
R7650:Muc5ac UTSW 7 141809422 missense unknown
R7651:Muc5ac UTSW 7 141796254 missense possibly damaging 0.92
R7685:Muc5ac UTSW 7 141809383 missense unknown
R7720:Muc5ac UTSW 7 141809303 missense unknown
R7749:Muc5ac UTSW 7 141809303 missense unknown
R7750:Muc5ac UTSW 7 141809303 missense unknown
R7751:Muc5ac UTSW 7 141809303 missense unknown
R7754:Muc5ac UTSW 7 141809303 missense unknown
R7798:Muc5ac UTSW 7 141794041 critical splice donor site probably null
R7835:Muc5ac UTSW 7 141809303 missense unknown
R7837:Muc5ac UTSW 7 141815963 missense possibly damaging 0.53
R7858:Muc5ac UTSW 7 141803429 missense possibly damaging 0.51
R7866:Muc5ac UTSW 7 141795852 missense probably benign 0.00
R7874:Muc5ac UTSW 7 141809303 missense unknown
R7876:Muc5ac UTSW 7 141809303 missense unknown
R7881:Muc5ac UTSW 7 141809303 missense unknown
R7884:Muc5ac UTSW 7 141809303 missense unknown
R7921:Muc5ac UTSW 7 141809687 intron probably benign
R7976:Muc5ac UTSW 7 141809791 missense unknown
R8104:Muc5ac UTSW 7 141804783 missense possibly damaging 0.96
R8177:Muc5ac UTSW 7 141807331 missense probably damaging 1.00
R8214:Muc5ac UTSW 7 141802948 missense possibly damaging 0.53
R8292:Muc5ac UTSW 7 141809263 missense unknown
R8386:Muc5ac UTSW 7 141807634 missense possibly damaging 0.93
R8400:Muc5ac UTSW 7 141810476 missense probably damaging 0.99
R8504:Muc5ac UTSW 7 141807155 missense probably damaging 1.00
X0060:Muc5ac UTSW 7 141803333 missense possibly damaging 0.71
Z1088:Muc5ac UTSW 7 141809744 intron probably benign
Z1088:Muc5ac UTSW 7 141811692 missense possibly damaging 0.86
Z1177:Muc5ac UTSW 7 141809224 missense unknown
Z1177:Muc5ac UTSW 7 141818040 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TCACCCAATACAGGAAAGGC -3'
(R):5'- GGTGCTGGCCTTTCCTGTAT -3'

Sequencing Primer
(F):5'- TACAGGAAAGGCCAGCACC -3'
(R):5'- CCTTTCCTGTATTGGGTGAGC -3'
Posted On2019-12-20