Mutagenetix > Incidental Mutations

Incidental Mutation 'R7877:Large1'

608511

Institutional Source

Beutler Lab

Gene Symbol

Large1

Ensembl Gene

ENSMUSG00000004383

Gene Name

LARGE xylosyl- and glucuronyltransferase 1

Synonyms

froggy, BPFD#36, fg, enr

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.588) question?

Stock #

R7877 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

72814599-73353540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 73116443 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 151 (R151W)

Ref Sequence

ENSEMBL: ENSMUSP00000004497 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004497] [ENSMUST00000119826] [ENSMUST00000212459]

AlphaFold

Q9Z1M7

Predicted Effect

probably damaging
Transcript: ENSMUST00000004497
AA Change: R151W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000004497
Gene: ENSMUSG00000004383
AA Change: R151W

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
coiled coil region	55	90	N/A	INTRINSIC
Pfam:Glyco_transf_8	141	387	6.2e-22	PFAM
Pfam:Glyco_transf_49	473	540	5.2e-15	PFAM
Pfam:Glyco_transf_49	535	743	1.1e-47	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000119826
AA Change: R151W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112617
Gene: ENSMUSG00000004383
AA Change: R151W

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
coiled coil region	55	90	N/A	INTRINSIC
Pfam:Glyco_transf_8	142	386	3e-23	PFAM
Pfam:Glyco_transf_49	473	540	2.3e-11	PFAM
Pfam:Glyco_transf_49	520	743	2.7e-44	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000212459
AA Change: R151W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes exhibit a progressive myopathy, abnormal posture, thoracic kyphosis, calcium deposits in muscle, loss of Schwann cells and myelin, eye and CNS defects, deafness, reduced growth, and death around 4 months. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	G	A	17: 9,001,833	C388Y	probably damaging	Het
1700029J07Rik	T	A	8: 45,970,399	K92M	probably damaging	Het
4930522L14Rik	G	A	5: 109,736,364	H543Y	probably damaging	Het
Abca1	A	T	4: 53,046,135	V1711E	possibly damaging	Het
Abca3	A	T	17: 24,384,023	K531*	probably null	Het
Adgrf5	A	T	17: 43,441,838	D557V	possibly damaging	Het
Adgrl3	A	G	5: 81,694,620	E865G	probably benign	Het
Adprhl1	T	A	8: 13,225,316	R481*	probably null	Het
Afap1l1	T	A	18: 61,746,782	D339V	probably damaging	Het
Atp9b	T	A	18: 80,847,197	H309L		Het
Baiap3	A	G	17: 25,251,138	V122A	probably damaging	Het
Btg4	T	C	9: 51,117,940	S142P	probably benign	Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Cdca2	T	A	14: 67,677,216	T865S	probably benign	Het
Cdk12	A	G	11: 98,240,835	Y964C	unknown	Het
Cenpo	A	T	12: 4,214,573	F273Y	probably damaging	Het
Chac1	T	A	2: 119,353,506	D196E	probably damaging	Het
Clec4n	T	C	6: 123,232,104	F43L	probably benign	Het
Colgalt1	T	A	8: 71,621,864	C407S	probably damaging	Het
Csnk1g1	T	A	9: 65,999,548		probably null	Het
Cyp2b23	T	A	7: 26,686,426	E2V	probably damaging	Het
Cyp51	T	A	5: 4,102,929	K91M	probably damaging	Het
Dnah8	G	T	17: 30,663,374	G640V	probably benign	Het
Dnajc2	G	T	5: 21,760,639	S505R	possibly damaging	Het
Fam124b	A	T	1: 80,213,336	L110H	probably damaging	Het
Fam49a	A	C	12: 12,364,797	Y263S	probably benign	Het
Fem1b	T	A	9: 62,796,562	Y472F	probably benign	Het
Frem1	A	G	4: 83,013,812		probably null	Het
Gabrg1	A	T	5: 70,816,072	D46E	probably damaging	Het
Gbp4	T	C	5: 105,118,295	K627E	probably benign	Het
Glis1	A	G	4: 107,634,703	D776G	probably damaging	Het
Gm4847	A	G	1: 166,640,006	V207A	possibly damaging	Het
Gm7298	T	A	6: 121,782,782	Y1213*	probably null	Het
Gm8229	T	A	14: 44,366,576	L74*	probably null	Het
Hc	A	T	2: 34,997,399	Y1364*	probably null	Het
Hnrnpa2b1	A	T	6: 51,466,322	S186R	unknown	Het
Hrh4	A	G	18: 13,022,525	I374V	possibly damaging	Het
Ighmbp2	A	G	19: 3,261,490	L975P	probably damaging	Het
Intu	G	A	3: 40,699,792	V905I	probably benign	Het
Limd2	G	A	11: 106,159,178	T24M	probably benign	Het
Med16	A	T	10: 79,898,372	C569*	probably null	Het
Mettl1	T	G	10: 127,044,521	V104G	possibly damaging	Het
Mgat4c	A	G	10: 102,385,039	T61A	probably benign	Het
Mrps31	T	A	8: 22,424,351	Y238N	probably benign	Het
Mrs2	T	C	13: 24,997,130	E236G	probably damaging	Het
Muc5ac	G	C	7: 141,809,303	G2117A	unknown	Het
Noxred1	G	A	12: 87,224,987	A136V	probably benign	Het
Obscn	T	A	11: 59,133,762	D484V	probably damaging	Het
Picalm	C	A	7: 90,130,668	H32Q	probably benign	Het
Pik3r5	G	A	11: 68,490,605	G206R	probably damaging	Het
Plekhh2	G	A	17: 84,575,006	C680Y	probably benign	Het
Plxna1	A	G	6: 89,323,259	F1614S	probably damaging	Het
Ppip5k1	T	C	2: 121,316,754	M1129V	probably benign	Het
Prp2	C	T	6: 132,595,965	T7I	unknown	Het
Rrbp1	A	T	2: 143,947,895		probably benign	Het
Sdhaf3	C	T	6: 7,038,855	T59M	probably benign	Het
Slc17a6	T	A	7: 51,625,505	I104N	probably benign	Het
Slc35c1	A	T	2: 92,459,057	W48R	probably damaging	Het
Slc5a4b	A	T	10: 76,075,052	C317S	probably damaging	Het
Smim13	G	T	13: 41,250,174		probably benign	Het
Snrpg	T	C	6: 86,378,779	V76A	probably benign	Het
Sntb2	C	T	8: 107,011,532	T509I	probably benign	Het
Sptbn1	T	C	11: 30,129,601	D1276G	possibly damaging	Het
Sptbn2	A	G	19: 4,744,262	E1498G	possibly damaging	Het
Stau1	T	A	2: 166,950,867	N393Y	possibly damaging	Het
Tars2	A	T	3: 95,746,089	S500T	probably damaging	Het
Tbc1d23	A	T	16: 57,173,125	D559E	probably benign	Het
Trav14-2	T	C	14: 53,641,051	Y64H	possibly damaging	Het
Trpm3	A	C	19: 22,904,784	E838D	probably benign	Het
Vmn1r23	G	A	6: 57,926,556	A79V	probably benign	Het
Vmn1r48	G	T	6: 90,036,449	N131K	probably benign	Het
Vmn2r18	A	T	5: 151,584,972	M229K	probably damaging	Het
Zbtb4	G	A	11: 69,776,037	R56K	probably benign	Het
Zfp616	G	T	11: 74,084,362	G486W	probably damaging	Het
Zkscan8	A	T	13: 21,520,410	F453Y	possibly damaging	Het

Other mutations in Large1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Large1	APN	8	72837497	missense	probably damaging	1.00
IGL00326:Large1	APN	8	73131983	missense	probably benign
IGL00418:Large1	APN	8	72823841	critical splice acceptor site	probably null
IGL01155:Large1	APN	8	73131989	missense	probably benign	0.01
IGL01793:Large1	APN	8	72859181	splice site	probably benign
IGL01929:Large1	APN	8	72859275	missense	probably damaging	1.00
IGL02218:Large1	APN	8	72912122	missense	probably damaging	1.00
IGL02276:Large1	APN	8	72818093	missense	probably benign	0.00
IGL02329:Large1	APN	8	73048317	missense	possibly damaging	0.80
IGL02543:Large1	APN	8	73048414	missense	probably benign	0.00
IGL02887:Large1	APN	8	73132039	missense	probably benign	0.07
biggs	UTSW	8	73116419	missense	probably damaging	1.00
umber	UTSW	8	72883264	nonsense	probably null
R0179:Large1	UTSW	8	73098846	missense	probably benign	0.09
R0477:Large1	UTSW	8	72818082	missense	probably damaging	1.00
R0587:Large1	UTSW	8	72859333	missense	probably damaging	1.00
R0791:Large1	UTSW	8	73048479	splice site	probably benign
R1253:Large1	UTSW	8	73048422	missense	probably damaging	0.98
R1695:Large1	UTSW	8	72818082	missense	probably damaging	1.00
R2017:Large1	UTSW	8	72852197	missense	probably damaging	1.00
R4835:Large1	UTSW	8	73048347	missense	probably damaging	1.00
R5105:Large1	UTSW	8	72852244	nonsense	probably null
R5120:Large1	UTSW	8	72859341	missense	probably damaging	1.00
R5135:Large1	UTSW	8	72818096	missense	probably benign	0.38
R5137:Large1	UTSW	8	73048309	missense	possibly damaging	0.58
R5567:Large1	UTSW	8	72837453	missense	possibly damaging	0.93
R5945:Large1	UTSW	8	72852200	missense	probably damaging	0.99
R6619:Large1	UTSW	8	72883264	nonsense	probably null
R6951:Large1	UTSW	8	73116419	missense	probably damaging	1.00
R7041:Large1	UTSW	8	73116464	missense	probably damaging	0.98
R7300:Large1	UTSW	8	72837596	missense	probably damaging	1.00
R7493:Large1	UTSW	8	72823715	missense	probably benign	0.23
R8118:Large1	UTSW	8	73131944	missense	probably benign	0.40
R8129:Large1	UTSW	8	72815957	missense	probably damaging	1.00
R8525:Large1	UTSW	8	72837492	missense	probably damaging	1.00
R8963:Large1	UTSW	8	72815984	missense	probably damaging	1.00
R9170:Large1	UTSW	8	72816017	missense	probably benign	0.00
Z1088:Large1	UTSW	8	72912103	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCTGGTAATGCTGAACCTCTG -3'
(R):5'- CAATGGCTGTATGCAGGGTC -3'

Sequencing Primer
(F):5'- GGTAATGCTGAACCTCTGCTATTAAG -3'
(R):5'- ATGCAGGGTCCTTGTTTTCTATAATC -3'

Posted On

2019-12-20