Incidental Mutation 'R7877:Sntb2'
ID608512
Institutional Source Beutler Lab
Gene Symbol Sntb2
Ensembl Gene ENSMUSG00000041308
Gene Namesyntrophin, basic 2
SynonymsSnt2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.666) question?
Stock #R7877 (G1)
Quality Score114.008
Status Not validated
Chromosome8
Chromosomal Location106935750-107019714 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 107011532 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 509 (T509I)
Ref Sequence ENSEMBL: ENSMUSP00000037324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047425] [ENSMUST00000212524]
Predicted Effect probably benign
Transcript: ENSMUST00000047425
AA Change: T509I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037324
Gene: ENSMUSG00000041308
AA Change: T509I

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
low complexity region 62 92 N/A INTRINSIC
low complexity region 93 99 N/A INTRINSIC
PDZ 104 178 1.48e-17 SMART
PH 144 282 3.52e0 SMART
PH 306 419 4.07e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212524
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dystrophin is a large, rod-like cytoskeletal protein found at the inner surface of muscle fibers. Dystrophin is missing in Duchenne Muscular Dystrophy patients and is present in reduced amounts in Becker Muscular Dystrophy patients. The protein encoded by this gene is a peripheral membrane protein found associated with dystrophin and dystrophin-related proteins. This gene is a member of the syntrophin gene family, which contains at least two other structurally-related genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have no overt phenotype. They are fertile and motile with no signs of muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,001,833 C388Y probably damaging Het
1700029J07Rik T A 8: 45,970,399 K92M probably damaging Het
4930522L14Rik G A 5: 109,736,364 H543Y probably damaging Het
Abca1 A T 4: 53,046,135 V1711E possibly damaging Het
Abca3 A T 17: 24,384,023 K531* probably null Het
Adgrf5 A T 17: 43,441,838 D557V possibly damaging Het
Adgrl3 A G 5: 81,694,620 E865G probably benign Het
Adprhl1 T A 8: 13,225,316 R481* probably null Het
Afap1l1 T A 18: 61,746,782 D339V probably damaging Het
Atp9b T A 18: 80,847,197 H309L Het
Baiap3 A G 17: 25,251,138 V122A probably damaging Het
Btg4 T C 9: 51,117,940 S142P probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdca2 T A 14: 67,677,216 T865S probably benign Het
Cdk12 A G 11: 98,240,835 Y964C unknown Het
Cenpo A T 12: 4,214,573 F273Y probably damaging Het
Chac1 T A 2: 119,353,506 D196E probably damaging Het
Clec4n T C 6: 123,232,104 F43L probably benign Het
Colgalt1 T A 8: 71,621,864 C407S probably damaging Het
Csnk1g1 T A 9: 65,999,548 probably null Het
Cyp2b23 T A 7: 26,686,426 E2V probably damaging Het
Cyp51 T A 5: 4,102,929 K91M probably damaging Het
Dnah8 G T 17: 30,663,374 G640V probably benign Het
Dnajc2 G T 5: 21,760,639 S505R possibly damaging Het
Fam124b A T 1: 80,213,336 L110H probably damaging Het
Fam49a A C 12: 12,364,797 Y263S probably benign Het
Fem1b T A 9: 62,796,562 Y472F probably benign Het
Frem1 A G 4: 83,013,812 probably null Het
Gabrg1 A T 5: 70,816,072 D46E probably damaging Het
Gbp4 T C 5: 105,118,295 K627E probably benign Het
Glis1 A G 4: 107,634,703 D776G probably damaging Het
Gm4847 A G 1: 166,640,006 V207A possibly damaging Het
Gm7298 T A 6: 121,782,782 Y1213* probably null Het
Gm8229 T A 14: 44,366,576 L74* probably null Het
Hc A T 2: 34,997,399 Y1364* probably null Het
Hnrnpa2b1 A T 6: 51,466,322 S186R unknown Het
Hrh4 A G 18: 13,022,525 I374V possibly damaging Het
Ighmbp2 A G 19: 3,261,490 L975P probably damaging Het
Intu G A 3: 40,699,792 V905I probably benign Het
Large1 T A 8: 73,116,443 R151W probably damaging Het
Limd2 G A 11: 106,159,178 T24M probably benign Het
Med16 A T 10: 79,898,372 C569* probably null Het
Mettl1 T G 10: 127,044,521 V104G possibly damaging Het
Mgat4c A G 10: 102,385,039 T61A probably benign Het
Mrps31 T A 8: 22,424,351 Y238N probably benign Het
Mrs2 T C 13: 24,997,130 E236G probably damaging Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Noxred1 G A 12: 87,224,987 A136V probably benign Het
Obscn T A 11: 59,133,762 D484V probably damaging Het
Picalm C A 7: 90,130,668 H32Q probably benign Het
Pik3r5 G A 11: 68,490,605 G206R probably damaging Het
Plekhh2 G A 17: 84,575,006 C680Y probably benign Het
Plxna1 A G 6: 89,323,259 F1614S probably damaging Het
Ppip5k1 T C 2: 121,316,754 M1129V probably benign Het
Prp2 C T 6: 132,595,965 T7I unknown Het
Rrbp1 A T 2: 143,947,895 probably benign Het
Sdhaf3 C T 6: 7,038,855 T59M probably benign Het
Slc17a6 T A 7: 51,625,505 I104N probably benign Het
Slc35c1 A T 2: 92,459,057 W48R probably damaging Het
Slc5a4b A T 10: 76,075,052 C317S probably damaging Het
Smim13 G T 13: 41,250,174 probably benign Het
Snrpg T C 6: 86,378,779 V76A probably benign Het
Sptbn1 T C 11: 30,129,601 D1276G possibly damaging Het
Sptbn2 A G 19: 4,744,262 E1498G possibly damaging Het
Stau1 T A 2: 166,950,867 N393Y possibly damaging Het
Tars2 A T 3: 95,746,089 S500T probably damaging Het
Tbc1d23 A T 16: 57,173,125 D559E probably benign Het
Trav14-2 T C 14: 53,641,051 Y64H possibly damaging Het
Trpm3 A C 19: 22,904,784 E838D probably benign Het
Vmn1r23 G A 6: 57,926,556 A79V probably benign Het
Vmn1r48 G T 6: 90,036,449 N131K probably benign Het
Vmn2r18 A T 5: 151,584,972 M229K probably damaging Het
Zbtb4 G A 11: 69,776,037 R56K probably benign Het
Zfp616 G T 11: 74,084,362 G486W probably damaging Het
Zkscan8 A T 13: 21,520,410 F453Y possibly damaging Het
Other mutations in Sntb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0226:Sntb2 UTSW 8 107001583 missense probably damaging 1.00
R0345:Sntb2 UTSW 8 107001538 missense probably damaging 1.00
R0766:Sntb2 UTSW 8 107001577 missense probably damaging 1.00
R1027:Sntb2 UTSW 8 106991571 missense probably benign 0.28
R1312:Sntb2 UTSW 8 107001577 missense probably damaging 1.00
R1514:Sntb2 UTSW 8 106991532 missense probably damaging 1.00
R1942:Sntb2 UTSW 8 107011352 missense probably damaging 0.98
R2937:Sntb2 UTSW 8 106936097 missense probably benign 0.06
R3968:Sntb2 UTSW 8 106997140 nonsense probably null
R4455:Sntb2 UTSW 8 106991607 critical splice donor site probably null
R4458:Sntb2 UTSW 8 106991607 critical splice donor site probably null
R4526:Sntb2 UTSW 8 107009963 missense probably damaging 0.99
R6123:Sntb2 UTSW 8 106981225 missense probably damaging 1.00
R7378:Sntb2 UTSW 8 106981312 missense probably damaging 1.00
R7458:Sntb2 UTSW 8 106936298 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGCATTCTTGTCCAAAGCCG -3'
(R):5'- AAGTGCCAGACTTCATAACAGGG -3'

Sequencing Primer
(F):5'- AGCCGATTGTATTTGTATTGCACACG -3'
(R):5'- TGCCAGACTTCATAACAGGGAAAAG -3'
Posted On2019-12-20