Incidental Mutation 'R7877:Noxred1'
ID 608529
Institutional Source Beutler Lab
Gene Symbol Noxred1
Ensembl Gene ENSMUSG00000072919
Gene Name NADP+ dependent oxidoreductase domain containing 1
Synonyms 4933437F05Rik
MMRRC Submission 045929-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R7877 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 87267897-87285375 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 87271761 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 136 (A136V)
Ref Sequence ENSEMBL: ENSMUSP00000152486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021423] [ENSMUST00000221768] [ENSMUST00000222480]
AlphaFold Q9D3S5
Predicted Effect probably benign
Transcript: ENSMUST00000021423
AA Change: A136V

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021423
Gene: ENSMUSG00000072919
AA Change: A136V

DomainStartEndE-ValueType
Pfam:F420_oxidored 80 173 1.1e-9 PFAM
low complexity region 261 269 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221768
AA Change: A136V

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000222480
AA Change: A136V

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G A 17: 9,220,665 (GRCm39) C388Y probably damaging Het
4930522L14Rik G A 5: 109,884,230 (GRCm39) H543Y probably damaging Het
Abca1 A T 4: 53,046,135 (GRCm39) V1711E possibly damaging Het
Abca3 A T 17: 24,602,997 (GRCm39) K531* probably null Het
Adgrf5 A T 17: 43,752,729 (GRCm39) D557V possibly damaging Het
Adgrl3 A G 5: 81,842,467 (GRCm39) E865G probably benign Het
Adprhl1 T A 8: 13,275,316 (GRCm39) R481* probably null Het
Afap1l1 T A 18: 61,879,853 (GRCm39) D339V probably damaging Het
Atp9b T A 18: 80,890,412 (GRCm39) H309L Het
Baiap3 A G 17: 25,470,112 (GRCm39) V122A probably damaging Het
Btg4 T C 9: 51,029,240 (GRCm39) S142P probably benign Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Ccng2 C G 5: 93,421,202 (GRCm39) S237R probably benign Het
Cdca2 T A 14: 67,914,665 (GRCm39) T865S probably benign Het
Cdk12 A G 11: 98,131,661 (GRCm39) Y964C unknown Het
Cenpo A T 12: 4,264,573 (GRCm39) F273Y probably damaging Het
Cfap96 T A 8: 46,423,436 (GRCm39) K92M probably damaging Het
Chac1 T A 2: 119,183,987 (GRCm39) D196E probably damaging Het
Clec4n T C 6: 123,209,063 (GRCm39) F43L probably benign Het
Colgalt1 T A 8: 72,074,508 (GRCm39) C407S probably damaging Het
Csnk1g1 T A 9: 65,906,830 (GRCm39) probably null Het
Cyp2b23 T A 7: 26,385,851 (GRCm39) E2V probably damaging Het
Cyp51 T A 5: 4,152,929 (GRCm39) K91M probably damaging Het
Cyria A C 12: 12,414,798 (GRCm39) Y263S probably benign Het
Dnah8 G T 17: 30,882,348 (GRCm39) G640V probably benign Het
Dnajc2 G T 5: 21,965,637 (GRCm39) S505R possibly damaging Het
Fam124b A T 1: 80,191,053 (GRCm39) L110H probably damaging Het
Fem1b T A 9: 62,703,844 (GRCm39) Y472F probably benign Het
Frem1 A G 4: 82,932,049 (GRCm39) probably null Het
Gabrg1 A T 5: 70,973,415 (GRCm39) D46E probably damaging Het
Gbp4 T C 5: 105,266,161 (GRCm39) K627E probably benign Het
Glis1 A G 4: 107,491,900 (GRCm39) D776G probably damaging Het
Gm4847 A G 1: 166,467,575 (GRCm39) V207A possibly damaging Het
Gm7298 T A 6: 121,759,741 (GRCm39) Y1213* probably null Het
Gm8229 T A 14: 44,604,033 (GRCm39) L74* probably null Het
Hc A T 2: 34,887,411 (GRCm39) Y1364* probably null Het
Hnrnpa2b1 A T 6: 51,443,302 (GRCm39) S186R unknown Het
Hrh4 A G 18: 13,155,582 (GRCm39) I374V possibly damaging Het
Ighmbp2 A G 19: 3,311,490 (GRCm39) L975P probably damaging Het
Intu G A 3: 40,654,222 (GRCm39) V905I probably benign Het
Large1 T A 8: 73,843,071 (GRCm39) R151W probably damaging Het
Limd2 G A 11: 106,050,004 (GRCm39) T24M probably benign Het
Med16 A T 10: 79,734,206 (GRCm39) C569* probably null Het
Mettl1 T G 10: 126,880,390 (GRCm39) V104G possibly damaging Het
Mgat4c A G 10: 102,220,900 (GRCm39) T61A probably benign Het
Mrps31 T A 8: 22,914,367 (GRCm39) Y238N probably benign Het
Mrs2 T C 13: 25,181,113 (GRCm39) E236G probably damaging Het
Muc5ac G C 7: 141,363,040 (GRCm39) G2117A unknown Het
Obscn T A 11: 59,024,588 (GRCm39) D484V probably damaging Het
Picalm C A 7: 89,779,876 (GRCm39) H32Q probably benign Het
Pik3r5 G A 11: 68,381,431 (GRCm39) G206R probably damaging Het
Plekhh2 G A 17: 84,882,434 (GRCm39) C680Y probably benign Het
Plxna1 A G 6: 89,300,241 (GRCm39) F1614S probably damaging Het
Ppip5k1 T C 2: 121,147,235 (GRCm39) M1129V probably benign Het
Prp2 C T 6: 132,572,928 (GRCm39) T7I unknown Het
Rrbp1 A T 2: 143,789,815 (GRCm39) probably benign Het
Sdhaf3 C T 6: 7,038,855 (GRCm39) T59M probably benign Het
Slc17a6 T A 7: 51,275,253 (GRCm39) I104N probably benign Het
Slc35c1 A T 2: 92,289,402 (GRCm39) W48R probably damaging Het
Slc5a4b A T 10: 75,910,886 (GRCm39) C317S probably damaging Het
Smim13 G T 13: 41,403,650 (GRCm39) probably benign Het
Snrpg T C 6: 86,355,761 (GRCm39) V76A probably benign Het
Sntb2 C T 8: 107,738,164 (GRCm39) T509I probably benign Het
Sptbn1 T C 11: 30,079,601 (GRCm39) D1276G possibly damaging Het
Sptbn2 A G 19: 4,794,290 (GRCm39) E1498G possibly damaging Het
Stau1 T A 2: 166,792,787 (GRCm39) N393Y possibly damaging Het
Tars2 A T 3: 95,653,401 (GRCm39) S500T probably damaging Het
Tbc1d23 A T 16: 56,993,488 (GRCm39) D559E probably benign Het
Trav14-2 T C 14: 53,878,508 (GRCm39) Y64H possibly damaging Het
Trpm3 A C 19: 22,882,148 (GRCm39) E838D probably benign Het
Vmn1r23 G A 6: 57,903,541 (GRCm39) A79V probably benign Het
Vmn1r48 G T 6: 90,013,431 (GRCm39) N131K probably benign Het
Vmn2r18 A T 5: 151,508,437 (GRCm39) M229K probably damaging Het
Zbtb4 G A 11: 69,666,863 (GRCm39) R56K probably benign Het
Zfp616 G T 11: 73,975,188 (GRCm39) G486W probably damaging Het
Zkscan8 A T 13: 21,704,580 (GRCm39) F453Y possibly damaging Het
Other mutations in Noxred1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01943:Noxred1 APN 12 87,269,955 (GRCm39) missense probably benign 0.05
IGL01950:Noxred1 APN 12 87,268,190 (GRCm39) missense probably damaging 1.00
IGL02381:Noxred1 APN 12 87,271,776 (GRCm39) missense probably damaging 0.98
IGL03109:Noxred1 APN 12 87,280,212 (GRCm39) missense probably damaging 1.00
PIT4402001:Noxred1 UTSW 12 87,273,855 (GRCm39) missense probably benign 0.00
PIT4504001:Noxred1 UTSW 12 87,271,653 (GRCm39) missense possibly damaging 0.89
R0242:Noxred1 UTSW 12 87,273,753 (GRCm39) missense probably benign 0.02
R0242:Noxred1 UTSW 12 87,273,753 (GRCm39) missense probably benign 0.02
R0514:Noxred1 UTSW 12 87,273,838 (GRCm39) missense probably benign 0.01
R0992:Noxred1 UTSW 12 87,271,000 (GRCm39) missense probably benign 0.15
R1626:Noxred1 UTSW 12 87,268,029 (GRCm39) makesense probably null
R2370:Noxred1 UTSW 12 87,273,820 (GRCm39) missense probably benign 0.00
R3692:Noxred1 UTSW 12 87,280,240 (GRCm39) missense probably benign 0.26
R4084:Noxred1 UTSW 12 87,280,258 (GRCm39) missense possibly damaging 0.67
R5868:Noxred1 UTSW 12 87,270,976 (GRCm39) missense possibly damaging 0.54
R6856:Noxred1 UTSW 12 87,273,810 (GRCm39) missense probably benign 0.00
R6977:Noxred1 UTSW 12 87,268,091 (GRCm39) missense probably null 0.00
R7388:Noxred1 UTSW 12 87,273,799 (GRCm39) missense probably damaging 0.99
R7535:Noxred1 UTSW 12 87,280,206 (GRCm39) missense probably benign 0.00
R7737:Noxred1 UTSW 12 87,268,136 (GRCm39) nonsense probably null
R7939:Noxred1 UTSW 12 87,268,105 (GRCm39) missense probably benign 0.00
R8772:Noxred1 UTSW 12 87,273,867 (GRCm39) missense probably benign 0.14
R8785:Noxred1 UTSW 12 87,270,940 (GRCm39) missense probably benign 0.00
R9470:Noxred1 UTSW 12 87,269,829 (GRCm39) missense possibly damaging 0.74
R9718:Noxred1 UTSW 12 87,271,692 (GRCm39) missense possibly damaging 0.91
Z1176:Noxred1 UTSW 12 87,269,831 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATGCCTAACTCCAAGAG -3'
(R):5'- GCTTAAGCTCACAGAGGCTTC -3'

Sequencing Primer
(F):5'- CTAACTCCAAGAGGTAGGCCAAG -3'
(R):5'- CAGAGGCTTCCAGGAACCAG -3'
Posted On 2019-12-20