Mutagenetix > Incidental Mutation

Incidental Mutation 'R0148:Zdbf2'

60853

Institutional Source

Beutler Lab

Gene Symbol

Zdbf2

Ensembl Gene

ENSMUSG00000027520

Gene Name

zinc finger, DBF-type containing 2

Synonyms

4930431J08Rik, 9330107J05Rik

MMRRC Submission

038432-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R0148 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

63273265-63314576 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 63304006 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 515 (Q515*)

Ref Sequence

ENSEMBL: ENSMUSP00000109767 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]

AlphaFold

Q5SS00

Predicted Effect

probably null
Transcript: ENSMUST00000029025
AA Change: Q515*

SMART Domains

Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: Q515*

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083151

Predicted Effect

probably null
Transcript: ENSMUST00000114132
AA Change: Q515*

SMART Domains

Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: Q515*

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Meta Mutation Damage Score

0.9638

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 96.0%
20x: 91.8%

Validation Efficiency

86% (30/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	C	6: 121,662,446		probably null	Het
Agtr1a	T	C	13: 30,381,944	S331P	probably benign	Het
Ank1	T	A	8: 23,123,977	N1545K	probably damaging	Het
Bahcc1	A	T	11: 120,268,404	Q152H	probably damaging	Het
Bend3	T	A	10: 43,511,950	Y780N	probably damaging	Het
Bod1l	G	T	5: 41,818,697	A1758E	possibly damaging	Het
Ctcfl	T	C	2: 173,118,547	D81G	possibly damaging	Het
Ddx39	C	T	8: 83,722,476	R298C	possibly damaging	Het
Dock8	T	C	19: 25,119,459	L577P	probably benign	Het
Drc1	A	T	5: 30,281,489	N13I	possibly damaging	Het
Efl1	T	C	7: 82,671,670	S104P	probably damaging	Het
Eml4	T	A	17: 83,421,652	N85K	probably damaging	Het
Epb41l4a	T	C	18: 33,798,800	T581A	probably damaging	Het
Epha3	T	C	16: 63,612,944	D446G	possibly damaging	Het
Fam209	G	T	2: 172,473,980	G92C	probably damaging	Het
Fbln1	G	A	15: 85,230,826	R193H	probably damaging	Het
Fbxw21	A	G	9: 109,148,017		probably null	Het
Fgf17	C	T	14: 70,638,873	R49Q	probably damaging	Het
Flnb	T	C	14: 7,939,077	S2307P	probably benign	Het
Galr1	A	G	18: 82,405,570	L194P	probably benign	Het
Gar1	T	C	3: 129,829,473	H89R	probably damaging	Het
Gbp4	T	A	5: 105,119,496	Y519F	probably benign	Het
Git1	A	G	11: 77,505,728	T601A	probably benign	Het
Gm10722	T	"C,A"	9: 3,001,405		probably null	Het
Gm5142	C	T	14: 59,178,670	R13H	possibly damaging	Het
Gria2	A	C	3: 80,707,731	W481G	probably damaging	Het
Homer2	T	C	7: 81,624,278	T57A	probably benign	Het
Hpse2	A	C	19: 42,931,660		probably null	Het
Hspb7	T	C	4: 141,423,991	I148T	probably damaging	Het
Htr1d	C	A	4: 136,443,477	T339K	probably damaging	Het
Il4ra	T	A	7: 125,575,537	C306S	probably damaging	Het
Kansl3	A	T	1: 36,353,816	C225S	probably damaging	Het
Lama3	G	A	18: 12,448,272	C596Y	probably damaging	Het
Lama5	T	C	2: 180,190,406	H1714R	probably benign	Het
March6	C	T	15: 31,490,612	V293M	probably damaging	Het
Med12l	A	G	3: 59,037,654	D100G	probably damaging	Het
Mettl14	G	A	3: 123,371,394	T316I	probably damaging	Het
Mmp15	A	T	8: 95,372,317	N591Y	probably benign	Het
Mrpl53	T	C	6: 83,109,537	L74P	probably damaging	Het
Mvp	C	T	7: 126,989,865	V577M	probably damaging	Het
Neb	T	C	2: 52,249,376	K140E	probably damaging	Het
Nfya	A	G	17: 48,398,998	V48A	possibly damaging	Het
Ngf	G	T	3: 102,509,803		probably benign	Het
Nipsnap3b	C	T	4: 53,017,088	A104V	possibly damaging	Het
Nlrp14	A	G	7: 107,182,721	Y375C	probably benign	Het
Nod1	A	G	6: 54,938,217	Y764H	probably damaging	Het
Olfr225	G	A	11: 59,613,494	V177M	probably damaging	Het
Olfr270	A	T	4: 52,971,232	I204F	probably benign	Het
Olfr873	T	G	9: 20,301,091	M297R	probably damaging	Het
Pcdhb19	A	T	18: 37,497,182	Q10L	probably benign	Het
Pdcl	T	C	2: 37,352,130	I203V	probably benign	Het
Peg10	C	A	6: 4,755,711	R96S	possibly damaging	Het
Pknox1	T	A	17: 31,604,790	N379K	probably benign	Het
Prodh	T	G	16: 18,077,813	Q360P	probably damaging	Het
Raf1	C	T	6: 115,632,973	G202S	probably benign	Het
Rgs11	T	A	17: 26,207,459		probably null	Het
Rilp	A	T	11: 75,510,233	H29L	probably damaging	Het
Rtel1	T	C	2: 181,321,046	C31R	probably damaging	Het
Rubcnl	T	A	14: 75,042,458	I427K	probably damaging	Het
Ryr1	C	A	7: 29,052,035	R3706L	probably damaging	Het
Ryr2	T	C	13: 11,714,548	D2396G	probably damaging	Het
Slc45a2	T	C	15: 11,025,868	S435P	probably damaging	Het
Spata17	A	G	1: 187,112,601	V111A	probably damaging	Het
Svep1	C	T	4: 58,116,608	D881N	possibly damaging	Het
Sypl2	T	A	3: 108,219,095	N67I	possibly damaging	Het
Tenm3	T	C	8: 48,236,720	Y1944C	probably damaging	Het
Tep1	A	T	14: 50,824,789	D2535E	possibly damaging	Het
Tkt	T	A	14: 30,572,220	I529N	probably damaging	Het
Trp53i11	T	G	2: 93,197,735	V39G	probably damaging	Het
Trpm2	C	T	10: 77,925,825	G997D	probably damaging	Het
Usp3	A	G	9: 66,540,167	V219A	possibly damaging	Het
Usp4	T	A	9: 108,391,671		probably null	Het
Wdfy3	A	G	5: 101,917,411	V1297A	probably benign	Het
Wdr46	T	A	17: 33,941,023	F70I	probably benign	Het
Xkr6	T	C	14: 63,819,549	V303A	unknown	Het
Zfhx2	A	G	14: 55,072,897	Y731H	possibly damaging	Het

Other mutations in Zdbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Zdbf2	APN	1	63306514	missense	possibly damaging	0.92
IGL00796:Zdbf2	APN	1	63307205	missense	probably benign	0.04
IGL00801:Zdbf2	APN	1	63303038	missense	possibly damaging	0.66
IGL02803:Zdbf2	APN	1	63303077	missense	possibly damaging	0.46
R0143:Zdbf2	UTSW	1	63308074	missense	probably benign	0.01
R0147:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0433:Zdbf2	UTSW	1	63306143	missense	possibly damaging	0.46
R0502:Zdbf2	UTSW	1	63305290	missense	possibly damaging	0.66
R0645:Zdbf2	UTSW	1	63304950	missense	possibly damaging	0.81
R0765:Zdbf2	UTSW	1	63305723	missense	possibly damaging	0.46
R1068:Zdbf2	UTSW	1	63303430	missense	possibly damaging	0.94
R1216:Zdbf2	UTSW	1	63303002	missense	possibly damaging	0.83
R1235:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R1352:Zdbf2	UTSW	1	63303053	missense	probably damaging	0.96
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1435:Zdbf2	UTSW	1	63303040	missense	possibly damaging	0.66
R1562:Zdbf2	UTSW	1	63303588	missense	possibly damaging	0.83
R1624:Zdbf2	UTSW	1	63303859	missense	possibly damaging	0.66
R1635:Zdbf2	UTSW	1	63304334	missense	possibly damaging	0.92
R1644:Zdbf2	UTSW	1	63308972	missense	possibly damaging	0.66
R1662:Zdbf2	UTSW	1	63304249	nonsense	probably null
R1700:Zdbf2	UTSW	1	63302741	missense	unknown
R1720:Zdbf2	UTSW	1	63303277	missense	possibly damaging	0.46
R1853:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1854:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1973:Zdbf2	UTSW	1	63309701	missense	unknown
R2336:Zdbf2	UTSW	1	63303464	missense	probably benign	0.00
R2428:Zdbf2	UTSW	1	63305615	missense	probably benign	0.04
R3010:Zdbf2	UTSW	1	63303065	missense	possibly damaging	0.92
R3034:Zdbf2	UTSW	1	63304205	missense	probably damaging	0.96
R3079:Zdbf2	UTSW	1	63307477	missense	probably benign	0.05
R3196:Zdbf2	UTSW	1	63308420	missense	possibly damaging	0.46
R3711:Zdbf2	UTSW	1	63308671	missense	possibly damaging	0.83
R3845:Zdbf2	UTSW	1	63308324	missense	possibly damaging	0.66
R4093:Zdbf2	UTSW	1	63309781	missense	possibly damaging	0.83
R4250:Zdbf2	UTSW	1	63302861	missense	possibly damaging	0.46
R4592:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R4721:Zdbf2	UTSW	1	63308792	missense	possibly damaging	0.46
R4779:Zdbf2	UTSW	1	63303238	missense	possibly damaging	0.66
R4928:Zdbf2	UTSW	1	63308814	missense	possibly damaging	0.81
R4943:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.92
R5025:Zdbf2	UTSW	1	63303650	missense	possibly damaging	0.82
R5095:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R5149:Zdbf2	UTSW	1	63304903	missense	possibly damaging	0.83
R5326:Zdbf2	UTSW	1	63304411	missense	possibly damaging	0.66
R5341:Zdbf2	UTSW	1	63307933	missense	probably benign	0.27
R5511:Zdbf2	UTSW	1	63305677	missense	probably benign	0.03
R5809:Zdbf2	UTSW	1	63305876	missense	possibly damaging	0.90
R5902:Zdbf2	UTSW	1	63306526	missense	possibly damaging	0.83
R6162:Zdbf2	UTSW	1	63280818	start gained	probably benign
R6245:Zdbf2	UTSW	1	63304433	missense	possibly damaging	0.46
R6332:Zdbf2	UTSW	1	63307822	missense	possibly damaging	0.66
R6361:Zdbf2	UTSW	1	63303321	missense	possibly damaging	0.66
R6489:Zdbf2	UTSW	1	63307478	missense	possibly damaging	0.46
R6517:Zdbf2	UTSW	1	63305520	missense	possibly damaging	0.81
R6624:Zdbf2	UTSW	1	63303914	missense	possibly damaging	0.46
R6643:Zdbf2	UTSW	1	63304508	missense	possibly damaging	0.82
R6786:Zdbf2	UTSW	1	63304520	missense	possibly damaging	0.46
R6808:Zdbf2	UTSW	1	63308528	missense	possibly damaging	0.66
R6896:Zdbf2	UTSW	1	63308872	missense	probably damaging	0.98
R6997:Zdbf2	UTSW	1	63290766	missense	probably benign	0.09
R7011:Zdbf2	UTSW	1	63306766	missense	possibly damaging	0.66
R7058:Zdbf2	UTSW	1	63307404	missense	possibly damaging	0.66
R7066:Zdbf2	UTSW	1	63307559	missense	probably benign
R7177:Zdbf2	UTSW	1	63294961	missense	possibly damaging	0.94
R7184:Zdbf2	UTSW	1	63306505	missense	possibly damaging	0.92
R7273:Zdbf2	UTSW	1	63303404	missense	possibly damaging	0.90
R7387:Zdbf2	UTSW	1	63304039	missense	possibly damaging	0.46
R7468:Zdbf2	UTSW	1	63307510	missense	probably benign
R7695:Zdbf2	UTSW	1	63307370	missense	possibly damaging	0.83
R7712:Zdbf2	UTSW	1	63305371	missense	possibly damaging	0.83
R7735:Zdbf2	UTSW	1	63304105	missense	possibly damaging	0.66
R7736:Zdbf2	UTSW	1	63308007	nonsense	probably null
R7759:Zdbf2	UTSW	1	63308376	missense	possibly damaging	0.46
R7796:Zdbf2	UTSW	1	63303424	missense	possibly damaging	0.90
R7908:Zdbf2	UTSW	1	63306827	missense	possibly damaging	0.46
R7970:Zdbf2	UTSW	1	63304171	missense	possibly damaging	0.92
R8076:Zdbf2	UTSW	1	63306101	missense	possibly damaging	0.92
R8152:Zdbf2	UTSW	1	63306413	missense	possibly damaging	0.92
R8195:Zdbf2	UTSW	1	63304066	missense	possibly damaging	0.83
R8272:Zdbf2	UTSW	1	63305983	missense	probably benign
R8306:Zdbf2	UTSW	1	63304075	missense	possibly damaging	0.66
R8309:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R8323:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.46
R8400:Zdbf2	UTSW	1	63304976	missense	possibly damaging	0.92
R8443:Zdbf2	UTSW	1	63306007	missense	possibly damaging	0.83
R8460:Zdbf2	UTSW	1	63309570	small deletion	probably benign
R8528:Zdbf2	UTSW	1	63303386	missense	possibly damaging	0.82
R8812:Zdbf2	UTSW	1	63308113	missense	probably benign	0.00
R8962:Zdbf2	UTSW	1	63308003	missense	probably benign	0.00
R9061:Zdbf2	UTSW	1	63307137	missense
R9072:Zdbf2	UTSW	1	63305764	missense	possibly damaging	0.83
R9232:Zdbf2	UTSW	1	63308009	missense	possibly damaging	0.66
R9257:Zdbf2	UTSW	1	63306241	missense	probably damaging	1.00
R9411:Zdbf2	UTSW	1	63304129	missense	probably damaging	0.97
R9470:Zdbf2	UTSW	1	63305625	missense	possibly damaging	0.82
R9606:Zdbf2	UTSW	1	63303377	missense	possibly damaging	0.92
R9621:Zdbf2	UTSW	1	63303476	missense	possibly damaging	0.66
RF021:Zdbf2	UTSW	1	63302652	missense	possibly damaging	0.82
X0018:Zdbf2	UTSW	1	63305351	missense	possibly damaging	0.92
X0027:Zdbf2	UTSW	1	63308007	nonsense	probably null
X0057:Zdbf2	UTSW	1	63305390	missense	possibly damaging	0.66
X0063:Zdbf2	UTSW	1	63305537	missense	probably benign	0.04
Z1176:Zdbf2	UTSW	1	63304245	missense	possibly damaging	0.83
Z1177:Zdbf2	UTSW	1	63304086	frame shift	probably null
Z1177:Zdbf2	UTSW	1	63309203	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TGAGTGCCCTATCTGAACTGACCG -3'
(R):5'- GCTGCATCACTGTCAGAGCTGAAAC -3'

Sequencing Primer
(F):5'- TATCTGAACTGACCGCCAGAG -3'
(R):5'- TGTCAGAGCTGAAACTACTTGACC -3'

Posted On

2013-07-24