Incidental Mutation 'R7878:Mtmr11'
ID608560
Institutional Source Beutler Lab
Gene Symbol Mtmr11
Ensembl Gene ENSMUSG00000045934
Gene Namemyotubularin related protein 11
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R7878 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location96162004-96171718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96169199 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 490 (K490R)
Ref Sequence ENSEMBL: ENSMUSP00000062341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054356] [ENSMUST00000076372] [ENSMUST00000129925]
Predicted Effect probably benign
Transcript: ENSMUST00000054356
AA Change: K490R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000062341
Gene: ENSMUSG00000045934
AA Change: K490R

DomainStartEndE-ValueType
Pfam:Myotub-related 191 323 1.7e-12 PFAM
Pfam:Myotub-related 312 488 1.3e-44 PFAM
Pfam:3-PAP 550 683 2.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076372
SMART Domains Protein: ENSMUSP00000075709
Gene: ENSMUSG00000068856

DomainStartEndE-ValueType
RRM 14 87 1.46e-25 SMART
RRM 101 175 5.07e-25 SMART
low complexity region 214 307 N/A INTRINSIC
low complexity region 310 423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129925
SMART Domains Protein: ENSMUSP00000118258
Gene: ENSMUSG00000045934

DomainStartEndE-ValueType
Pfam:Myotub-related 162 264 4.2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,284,022 R4385W probably benign Het
Ahi1 G A 10: 20,981,431 probably null Het
Ak7 T A 12: 105,766,749 I584N probably damaging Het
Akip1 A T 7: 109,707,402 Y102F probably damaging Het
Alg9 T C 9: 50,842,783 Y588H probably benign Het
Arid1a A T 4: 133,687,271 N831K unknown Het
Armc4 G T 18: 7,217,801 H638N probably benign Het
Bcl2l11 T A 2: 128,128,688 L19* probably null Het
Btn1a1 T C 13: 23,459,044 T412A possibly damaging Het
Ccbe1 T C 18: 66,076,391 N193D possibly damaging Het
Ccdc114 A G 7: 45,924,560 E17G possibly damaging Het
Cd96 A G 16: 46,117,776 S109P probably damaging Het
Cdh23 A C 10: 60,314,200 I2622S possibly damaging Het
Cmya5 G T 13: 93,089,757 T2941K probably damaging Het
Cntn1 T C 15: 92,295,053 Y679H probably damaging Het
Cpsf1 A G 15: 76,600,500 V619A probably damaging Het
Elp5 T A 11: 69,970,599 I185F probably damaging Het
Frem1 A G 4: 83,020,680 V55A probably benign Het
Gm8251 T C 1: 44,056,014 S1975G probably benign Het
Kif1b A T 4: 149,214,997 Y985N probably damaging Het
Lao1 A G 4: 118,967,422 N234D probably benign Het
Lima1 C T 15: 99,819,550 V192I probably benign Het
Lrp2 T G 2: 69,507,809 D1209A probably damaging Het
Lrp2 C A 2: 69,507,810 D1209Y probably damaging Het
Luzp1 A G 4: 136,541,852 H462R probably benign Het
Mab21l1 A T 3: 55,784,017 T342S probably benign Het
Mst1 T C 9: 108,084,613 V657A probably benign Het
Myh3 A G 11: 67,087,251 D383G probably damaging Het
Nectin1 G A 9: 43,803,901 G478D probably benign Het
Nrip1 A G 16: 76,294,666 M1T probably null Het
Olfr338 A G 2: 36,377,133 D119G probably damaging Het
Olfr625-ps1 A T 7: 103,683,264 H182L probably damaging Het
Pnisr C A 4: 21,874,370 F704L unknown Het
Ptpn21 T A 12: 98,715,128 K82N probably damaging Het
Pyroxd2 T G 19: 42,742,665 probably null Het
Pzp A G 6: 128,512,311 S446P possibly damaging Het
Rbck1 T A 2: 152,318,410 I450F probably damaging Het
Rnase4 T A 14: 51,104,876 L19Q probably damaging Het
Rrp9 A G 9: 106,481,317 E118G probably damaging Het
Sec22a A G 16: 35,347,635 S169P probably benign Het
Sema5b G A 16: 35,661,626 S957N probably benign Het
Serpina3g A T 12: 104,238,102 probably benign Het
Skint2 A T 4: 112,649,745 I322F possibly damaging Het
Sspo G A 6: 48,492,526 C4471Y probably damaging Het
Stk16 T A 1: 75,212,945 L167* probably null Het
Tanc2 G A 11: 105,913,415 R245H Het
Tdpoz1 G A 3: 93,671,124 Q118* probably null Het
Tekt3 C T 11: 63,070,451 R149* probably null Het
Tenm4 A G 7: 96,852,357 E1256G probably damaging Het
Tie1 G A 4: 118,478,424 R791C probably damaging Het
Tpr T A 1: 150,423,660 S1204T possibly damaging Het
Trim28 G T 7: 13,024,362 probably benign Het
Ucp1 A G 8: 83,297,892 N282S probably benign Het
Unc80 T A 1: 66,601,141 D1402E possibly damaging Het
Vmn1r69 T A 7: 10,580,790 T5S probably benign Het
Zfyve28 T A 5: 34,199,655 K733M probably damaging Het
Other mutations in Mtmr11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02539:Mtmr11 APN 3 96164991 intron probably benign
R1017:Mtmr11 UTSW 3 96164477 missense probably damaging 1.00
R1589:Mtmr11 UTSW 3 96168113 missense probably benign 0.16
R1836:Mtmr11 UTSW 3 96164786 missense probably damaging 0.98
R2264:Mtmr11 UTSW 3 96169097 missense possibly damaging 0.53
R3623:Mtmr11 UTSW 3 96165266 missense probably damaging 1.00
R4195:Mtmr11 UTSW 3 96167891 splice site probably benign
R4243:Mtmr11 UTSW 3 96168077 missense probably damaging 1.00
R4245:Mtmr11 UTSW 3 96168077 missense probably damaging 1.00
R4414:Mtmr11 UTSW 3 96167891 splice site probably benign
R4417:Mtmr11 UTSW 3 96167891 splice site probably benign
R4461:Mtmr11 UTSW 3 96167891 splice site probably benign
R4468:Mtmr11 UTSW 3 96167891 splice site probably benign
R4963:Mtmr11 UTSW 3 96163250 intron probably benign
R5134:Mtmr11 UTSW 3 96169907 missense probably damaging 1.00
R5154:Mtmr11 UTSW 3 96164319 missense probably benign 0.03
R5508:Mtmr11 UTSW 3 96163767 missense probably damaging 1.00
R5821:Mtmr11 UTSW 3 96167869 missense possibly damaging 0.91
R5868:Mtmr11 UTSW 3 96171202 missense possibly damaging 0.65
R5991:Mtmr11 UTSW 3 96168589 splice site probably null
R6084:Mtmr11 UTSW 3 96168084 missense probably damaging 0.99
R6354:Mtmr11 UTSW 3 96168676 missense probably benign 0.07
R6446:Mtmr11 UTSW 3 96171188 missense probably benign 0.00
R6821:Mtmr11 UTSW 3 96170407 missense probably benign
R7033:Mtmr11 UTSW 3 96169946 missense probably damaging 1.00
R7312:Mtmr11 UTSW 3 96164538 missense possibly damaging 0.68
R7899:Mtmr11 UTSW 3 96170428 missense probably damaging 1.00
R8479:Mtmr11 UTSW 3 96163734 missense probably damaging 1.00
R8923:Mtmr11 UTSW 3 96164871 missense probably damaging 1.00
X0019:Mtmr11 UTSW 3 96164492 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAGGTGCTTGCAGACAC -3'
(R):5'- AAACCAGTTTGTGTCCCTGTCC -3'

Sequencing Primer
(F):5'- GCTTGCAGACACCCCCATG -3'
(R):5'- GTCCCTGTCCTACACCTGGAAC -3'
Posted On2019-12-20