Incidental Mutation 'R7878:Trim28'
ID608573
Institutional Source Beutler Lab
Gene Symbol Trim28
Ensembl Gene ENSMUSG00000005566
Gene Nametripartite motif-containing 28
SynonymsKRIP-1, Tif1b, KAP-1, MommeD9
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7878 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location12999114-13031035 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to T at 13024362 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000005705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005705]
Predicted Effect probably benign
Transcript: ENSMUST00000005705
SMART Domains Protein: ENSMUSP00000005705
Gene: ENSMUSG00000005566

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
low complexity region 37 57 N/A INTRINSIC
RING 66 121 1.2e-7 SMART
BBOX 149 196 2.97e-12 SMART
BBOX 205 246 1.11e-11 SMART
BBC 253 379 7.92e-39 SMART
low complexity region 420 432 N/A INTRINSIC
low complexity region 525 551 N/A INTRINSIC
low complexity region 555 576 N/A INTRINSIC
PHD 627 670 2.16e-9 SMART
RING 628 669 8.32e0 SMART
BROMO 697 801 6.5e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene mediates transcriptional control by interaction with the Kruppel-associated box repression domain found in many transcription factors. The protein localizes to the nucleus and is thought to associate with specific chromatin regions. The protein is a member of the tripartite motif family. This tripartite motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted disruption of this gene develop normally until the blastocyst stage and undergo uterine implantation, but become arrested at the early egg-cylinder stage, fail to gastrulate, and are completely resorbed by E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,284,022 R4385W probably benign Het
Ahi1 G A 10: 20,981,431 probably null Het
Ak7 T A 12: 105,766,749 I584N probably damaging Het
Akip1 A T 7: 109,707,402 Y102F probably damaging Het
Alg9 T C 9: 50,842,783 Y588H probably benign Het
Arid1a A T 4: 133,687,271 N831K unknown Het
Armc4 G T 18: 7,217,801 H638N probably benign Het
Bcl2l11 T A 2: 128,128,688 L19* probably null Het
Btn1a1 T C 13: 23,459,044 T412A possibly damaging Het
Ccbe1 T C 18: 66,076,391 N193D possibly damaging Het
Ccdc114 A G 7: 45,924,560 E17G possibly damaging Het
Cd96 A G 16: 46,117,776 S109P probably damaging Het
Cdh23 A C 10: 60,314,200 I2622S possibly damaging Het
Cmya5 G T 13: 93,089,757 T2941K probably damaging Het
Cntn1 T C 15: 92,295,053 Y679H probably damaging Het
Cpsf1 A G 15: 76,600,500 V619A probably damaging Het
Elp5 T A 11: 69,970,599 I185F probably damaging Het
Frem1 A G 4: 83,020,680 V55A probably benign Het
Gm8251 T C 1: 44,056,014 S1975G probably benign Het
Kif1b A T 4: 149,214,997 Y985N probably damaging Het
Lao1 A G 4: 118,967,422 N234D probably benign Het
Lima1 C T 15: 99,819,550 V192I probably benign Het
Lrp2 T G 2: 69,507,809 D1209A probably damaging Het
Lrp2 C A 2: 69,507,810 D1209Y probably damaging Het
Luzp1 A G 4: 136,541,852 H462R probably benign Het
Mab21l1 A T 3: 55,784,017 T342S probably benign Het
Mst1 T C 9: 108,084,613 V657A probably benign Het
Mtmr11 A G 3: 96,169,199 K490R probably benign Het
Myh3 A G 11: 67,087,251 D383G probably damaging Het
Nectin1 G A 9: 43,803,901 G478D probably benign Het
Nrip1 A G 16: 76,294,666 M1T probably null Het
Olfr338 A G 2: 36,377,133 D119G probably damaging Het
Olfr625-ps1 A T 7: 103,683,264 H182L probably damaging Het
Pnisr C A 4: 21,874,370 F704L unknown Het
Ptpn21 T A 12: 98,715,128 K82N probably damaging Het
Pyroxd2 T G 19: 42,742,665 probably null Het
Pzp A G 6: 128,512,311 S446P possibly damaging Het
Rbck1 T A 2: 152,318,410 I450F probably damaging Het
Rnase4 T A 14: 51,104,876 L19Q probably damaging Het
Rrp9 A G 9: 106,481,317 E118G probably damaging Het
Sec22a A G 16: 35,347,635 S169P probably benign Het
Sema5b G A 16: 35,661,626 S957N probably benign Het
Serpina3g A T 12: 104,238,102 probably benign Het
Skint2 A T 4: 112,649,745 I322F possibly damaging Het
Sspo G A 6: 48,492,526 C4471Y probably damaging Het
Stk16 T A 1: 75,212,945 L167* probably null Het
Tanc2 G A 11: 105,913,415 R245H Het
Tdpoz1 G A 3: 93,671,124 Q118* probably null Het
Tekt3 C T 11: 63,070,451 R149* probably null Het
Tenm4 A G 7: 96,852,357 E1256G probably damaging Het
Tie1 G A 4: 118,478,424 R791C probably damaging Het
Tpr T A 1: 150,423,660 S1204T possibly damaging Het
Ucp1 A G 8: 83,297,892 N282S probably benign Het
Unc80 T A 1: 66,601,141 D1402E possibly damaging Het
Vmn1r69 T A 7: 10,580,790 T5S probably benign Het
Zfyve28 T A 5: 34,199,655 K733M probably damaging Het
Other mutations in Trim28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Trim28 APN 7 13030702 missense probably damaging 1.00
R0113:Trim28 UTSW 7 13028701 missense probably damaging 1.00
R0610:Trim28 UTSW 7 13025784 splice site probably benign
R1558:Trim28 UTSW 7 13027834 missense probably damaging 1.00
R1650:Trim28 UTSW 7 13030849 missense possibly damaging 0.79
R3120:Trim28 UTSW 7 13028414 missense probably damaging 1.00
R4022:Trim28 UTSW 7 13028558 unclassified probably benign
R4173:Trim28 UTSW 7 13029878 missense probably benign 0.00
R4237:Trim28 UTSW 7 13027911 missense possibly damaging 0.94
R4379:Trim28 UTSW 7 13029480 missense probably damaging 0.99
R5206:Trim28 UTSW 7 13025348 missense probably benign 0.01
R5754:Trim28 UTSW 7 13029109 missense probably benign 0.12
R6788:Trim28 UTSW 7 13025346 missense probably benign 0.00
R6864:Trim28 UTSW 7 13029458 missense possibly damaging 0.85
R7089:Trim28 UTSW 7 13024906 missense probably damaging 0.99
R7588:Trim28 UTSW 7 13029420 missense probably damaging 1.00
R7677:Trim28 UTSW 7 13028113 missense possibly damaging 0.92
R7861:Trim28 UTSW 7 13028412 missense possibly damaging 0.67
R8814:Trim28 UTSW 7 13028527 missense probably damaging 0.96
X0050:Trim28 UTSW 7 13029471 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GCCTAAGGTTCGGCTCTG -3'
(R):5'- TGTCGAGATGCGGCCAAG -3'

Sequencing Primer
(F):5'- TAAGGTTCGGCTCTGCAGGAC -3'
(R):5'- CTCGCTTCTGAGACACT -3'
Posted On2019-12-20