Incidental Mutation 'R7878:Ccdc114'
ID608574
Institutional Source Beutler Lab
Gene Symbol Ccdc114
Ensembl Gene ENSMUSG00000040189
Gene Namecoiled-coil domain containing 114
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7878 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location45924072-45948963 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45924560 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 17 (E17G)
Ref Sequence ENSEMBL: ENSMUSP00000147658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038720] [ENSMUST00000038876] [ENSMUST00000164119] [ENSMUST00000210039] [ENSMUST00000210297] [ENSMUST00000210602] [ENSMUST00000210867] [ENSMUST00000210939] [ENSMUST00000211367]
Predicted Effect probably benign
Transcript: ENSMUST00000038720
SMART Domains Protein: ENSMUSP00000042772
Gene: ENSMUSG00000040189

DomainStartEndE-ValueType
coiled coil region 11 94 N/A INTRINSIC
coiled coil region 137 156 N/A INTRINSIC
low complexity region 174 185 N/A INTRINSIC
coiled coil region 195 229 N/A INTRINSIC
coiled coil region 303 380 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 504 519 N/A INTRINSIC
low complexity region 558 588 N/A INTRINSIC
low complexity region 592 604 N/A INTRINSIC
low complexity region 621 656 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038876
SMART Domains Protein: ENSMUSP00000037289
Gene: ENSMUSG00000040212

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 156 7.2e-47 PFAM
Pfam:Claudin_2 13 158 8.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164119
SMART Domains Protein: ENSMUSP00000132519
Gene: ENSMUSG00000040212

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 156 7.2e-47 PFAM
Pfam:Claudin_2 13 158 8.8e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000210039
AA Change: E17G

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000210297
Predicted Effect possibly damaging
Transcript: ENSMUST00000210602
AA Change: E17G

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000210867
Predicted Effect probably benign
Transcript: ENSMUST00000210939
Predicted Effect possibly damaging
Transcript: ENSMUST00000211367
AA Change: E17G

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein that is a component of the outer dynein arm docking complex in cilia cells. Mutations in this gene may cause primary ciliary dyskinesia 20. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,284,022 R4385W probably benign Het
Ahi1 G A 10: 20,981,431 probably null Het
Ak7 T A 12: 105,766,749 I584N probably damaging Het
Akip1 A T 7: 109,707,402 Y102F probably damaging Het
Alg9 T C 9: 50,842,783 Y588H probably benign Het
Arid1a A T 4: 133,687,271 N831K unknown Het
Armc4 G T 18: 7,217,801 H638N probably benign Het
Bcl2l11 T A 2: 128,128,688 L19* probably null Het
Btn1a1 T C 13: 23,459,044 T412A possibly damaging Het
Ccbe1 T C 18: 66,076,391 N193D possibly damaging Het
Cd96 A G 16: 46,117,776 S109P probably damaging Het
Cdh23 A C 10: 60,314,200 I2622S possibly damaging Het
Cmya5 G T 13: 93,089,757 T2941K probably damaging Het
Cntn1 T C 15: 92,295,053 Y679H probably damaging Het
Cpsf1 A G 15: 76,600,500 V619A probably damaging Het
Elp5 T A 11: 69,970,599 I185F probably damaging Het
Frem1 A G 4: 83,020,680 V55A probably benign Het
Gm8251 T C 1: 44,056,014 S1975G probably benign Het
Kif1b A T 4: 149,214,997 Y985N probably damaging Het
Lao1 A G 4: 118,967,422 N234D probably benign Het
Lima1 C T 15: 99,819,550 V192I probably benign Het
Lrp2 T G 2: 69,507,809 D1209A probably damaging Het
Lrp2 C A 2: 69,507,810 D1209Y probably damaging Het
Luzp1 A G 4: 136,541,852 H462R probably benign Het
Mab21l1 A T 3: 55,784,017 T342S probably benign Het
Mst1 T C 9: 108,084,613 V657A probably benign Het
Mtmr11 A G 3: 96,169,199 K490R probably benign Het
Myh3 A G 11: 67,087,251 D383G probably damaging Het
Nectin1 G A 9: 43,803,901 G478D probably benign Het
Nrip1 A G 16: 76,294,666 M1T probably null Het
Olfr338 A G 2: 36,377,133 D119G probably damaging Het
Olfr625-ps1 A T 7: 103,683,264 H182L probably damaging Het
Pnisr C A 4: 21,874,370 F704L unknown Het
Ptpn21 T A 12: 98,715,128 K82N probably damaging Het
Pyroxd2 T G 19: 42,742,665 probably null Het
Pzp A G 6: 128,512,311 S446P possibly damaging Het
Rbck1 T A 2: 152,318,410 I450F probably damaging Het
Rnase4 T A 14: 51,104,876 L19Q probably damaging Het
Rrp9 A G 9: 106,481,317 E118G probably damaging Het
Sec22a A G 16: 35,347,635 S169P probably benign Het
Sema5b G A 16: 35,661,626 S957N probably benign Het
Serpina3g A T 12: 104,238,102 probably benign Het
Skint2 A T 4: 112,649,745 I322F possibly damaging Het
Sspo G A 6: 48,492,526 C4471Y probably damaging Het
Stk16 T A 1: 75,212,945 L167* probably null Het
Tanc2 G A 11: 105,913,415 R245H Het
Tdpoz1 G A 3: 93,671,124 Q118* probably null Het
Tekt3 C T 11: 63,070,451 R149* probably null Het
Tenm4 A G 7: 96,852,357 E1256G probably damaging Het
Tie1 G A 4: 118,478,424 R791C probably damaging Het
Tpr T A 1: 150,423,660 S1204T possibly damaging Het
Trim28 G T 7: 13,024,362 probably benign Het
Ucp1 A G 8: 83,297,892 N282S probably benign Het
Unc80 T A 1: 66,601,141 D1402E possibly damaging Het
Vmn1r69 T A 7: 10,580,790 T5S probably benign Het
Zfyve28 T A 5: 34,199,655 K733M probably damaging Het
Other mutations in Ccdc114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Ccdc114 APN 7 45942656 missense probably damaging 1.00
IGL01383:Ccdc114 APN 7 45939700 missense probably damaging 1.00
IGL01826:Ccdc114 APN 7 45948386 missense possibly damaging 0.62
R0865:Ccdc114 UTSW 7 45942088 missense probably benign 0.17
R1061:Ccdc114 UTSW 7 45941755 missense probably damaging 0.96
R1217:Ccdc114 UTSW 7 45942758 splice site probably benign
R1533:Ccdc114 UTSW 7 45942858 missense probably benign 0.00
R2863:Ccdc114 UTSW 7 45948312 missense probably benign 0.04
R3954:Ccdc114 UTSW 7 45941676 missense probably damaging 1.00
R4774:Ccdc114 UTSW 7 45948380 missense probably damaging 0.99
R4861:Ccdc114 UTSW 7 45942873 missense probably damaging 0.98
R4861:Ccdc114 UTSW 7 45942873 missense probably damaging 0.98
R4952:Ccdc114 UTSW 7 45942191 missense probably damaging 1.00
R5074:Ccdc114 UTSW 7 45929090 missense probably benign 0.05
R5187:Ccdc114 UTSW 7 45929116 missense probably damaging 1.00
R5265:Ccdc114 UTSW 7 45947435 missense probably damaging 1.00
R5364:Ccdc114 UTSW 7 45936332 missense probably damaging 0.99
R5377:Ccdc114 UTSW 7 45942082 nonsense probably null
R6221:Ccdc114 UTSW 7 45947479 missense probably damaging 1.00
R6246:Ccdc114 UTSW 7 45936364 missense probably damaging 1.00
R6324:Ccdc114 UTSW 7 45941710 missense probably damaging 1.00
R6389:Ccdc114 UTSW 7 45948516 missense probably benign 0.32
R6542:Ccdc114 UTSW 7 45948390 missense probably benign 0.00
R6593:Ccdc114 UTSW 7 45947384 missense probably damaging 0.96
R7215:Ccdc114 UTSW 7 45936622 missense probably damaging 1.00
R7401:Ccdc114 UTSW 7 45942765 missense probably damaging 1.00
R7431:Ccdc114 UTSW 7 45929246 missense probably damaging 0.99
R7725:Ccdc114 UTSW 7 45948411 missense probably damaging 0.98
R8036:Ccdc114 UTSW 7 45942852 missense probably benign 0.06
R8681:Ccdc114 UTSW 7 45941839 missense probably damaging 0.96
R8686:Ccdc114 UTSW 7 45947692 missense probably benign 0.20
X0064:Ccdc114 UTSW 7 45948393 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GAGCGATATCCCAGTAGTCCTTG -3'
(R):5'- ACCACTCCTGAAGTCCAATGTC -3'

Sequencing Primer
(F):5'- ATATCCCAGTAGTCCTTGAAGGGTC -3'
(R):5'- TGAAGTCCAATGTCTGCCTAG -3'
Posted On2019-12-20