Incidental Mutation 'R0148:Ctcfl'
ID60858
Institutional Source Beutler Lab
Gene Symbol Ctcfl
Ensembl Gene ENSMUSG00000070495
Gene NameCCCTC-binding factor (zinc finger protein)-like
SynonymsBoris, OTTMUSG00000016680
MMRRC Submission 038432-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #R0148 (G1)
Quality Score178
Status Not validated
Chromosome2
Chromosomal Location173093609-173119525 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 173118547 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 81 (D81G)
Ref Sequence ENSEMBL: ENSMUSP00000135932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094287] [ENSMUST00000179693]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094287
AA Change: D81G

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000091845
Gene: ENSMUSG00000070495
AA Change: D81G

DomainStartEndE-ValueType
low complexity region 194 202 N/A INTRINSIC
ZnF_C2H2 257 279 1.79e-2 SMART
ZnF_C2H2 285 307 1.07e0 SMART
ZnF_C2H2 313 336 4.47e-3 SMART
ZnF_C2H2 342 364 1.79e-2 SMART
ZnF_C2H2 370 392 5.81e-2 SMART
ZnF_C2H2 398 421 1.36e-2 SMART
ZnF_C2H2 428 451 6.23e-2 SMART
ZnF_C2H2 458 480 1.89e-1 SMART
ZnF_C2H2 486 508 8.94e-3 SMART
ZnF_C2H2 514 537 2.32e-1 SMART
ZnF_C2H2 546 572 5.2e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144256
Predicted Effect possibly damaging
Transcript: ENSMUST00000179693
AA Change: D81G

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135932
Gene: ENSMUSG00000070495
AA Change: D81G

DomainStartEndE-ValueType
low complexity region 194 202 N/A INTRINSIC
ZnF_C2H2 257 279 1.79e-2 SMART
ZnF_C2H2 285 307 1.07e0 SMART
ZnF_C2H2 313 336 4.47e-3 SMART
ZnF_C2H2 342 364 1.79e-2 SMART
ZnF_C2H2 370 392 5.81e-2 SMART
ZnF_C2H2 398 421 1.36e-2 SMART
ZnF_C2H2 428 451 6.23e-2 SMART
ZnF_C2H2 458 480 1.89e-1 SMART
ZnF_C2H2 486 508 8.94e-3 SMART
ZnF_C2H2 514 537 2.32e-1 SMART
ZnF_C2H2 546 572 5.2e0 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 86% (30/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CCCTC-binding factor (CTCF), an 11-zinc-finger factor involved in gene regulation, utilizes different zinc fingers to bind varying DNA target sites. CTCF forms methylation-sensitive insulators that regulate X-chromosome inactivation. This gene is a paralog of CTCF and appears to be expressed primarily in the cytoplasm of spermatocytes, unlike CTCF which is expressed primarily in the nucleus of somatic cells. CTCF and the protein encoded by this gene are normally expressed in a mutually exclusive pattern that correlates with resetting of methylation marks during male germ cell differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small testes, delayed spermatid development, and increased male germ cell apoptosis without affecting fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,662,446 probably null Het
Agtr1a T C 13: 30,381,944 S331P probably benign Het
Ank1 T A 8: 23,123,977 N1545K probably damaging Het
Bahcc1 A T 11: 120,268,404 Q152H probably damaging Het
Bend3 T A 10: 43,511,950 Y780N probably damaging Het
Bod1l G T 5: 41,818,697 A1758E possibly damaging Het
Ddx39 C T 8: 83,722,476 R298C possibly damaging Het
Dock8 T C 19: 25,119,459 L577P probably benign Het
Drc1 A T 5: 30,281,489 N13I possibly damaging Het
Efl1 T C 7: 82,671,670 S104P probably damaging Het
Eml4 T A 17: 83,421,652 N85K probably damaging Het
Epb41l4a T C 18: 33,798,800 T581A probably damaging Het
Epha3 T C 16: 63,612,944 D446G possibly damaging Het
Fam209 G T 2: 172,473,980 G92C probably damaging Het
Fbln1 G A 15: 85,230,826 R193H probably damaging Het
Fbxw21 A G 9: 109,148,017 probably null Het
Fgf17 C T 14: 70,638,873 R49Q probably damaging Het
Flnb T C 14: 7,939,077 S2307P probably benign Het
Galr1 A G 18: 82,405,570 L194P probably benign Het
Gar1 T C 3: 129,829,473 H89R probably damaging Het
Gbp4 T A 5: 105,119,496 Y519F probably benign Het
Git1 A G 11: 77,505,728 T601A probably benign Het
Gm10722 T "C,A" 9: 3,001,405 probably null Het
Gm5142 C T 14: 59,178,670 R13H possibly damaging Het
Gria2 A C 3: 80,707,731 W481G probably damaging Het
Homer2 T C 7: 81,624,278 T57A probably benign Het
Hpse2 A C 19: 42,931,660 probably null Het
Hspb7 T C 4: 141,423,991 I148T probably damaging Het
Htr1d C A 4: 136,443,477 T339K probably damaging Het
Il4ra T A 7: 125,575,537 C306S probably damaging Het
Kansl3 A T 1: 36,353,816 C225S probably damaging Het
Lama3 G A 18: 12,448,272 C596Y probably damaging Het
Lama5 T C 2: 180,190,406 H1714R probably benign Het
March6 C T 15: 31,490,612 V293M probably damaging Het
Med12l A G 3: 59,037,654 D100G probably damaging Het
Mettl14 G A 3: 123,371,394 T316I probably damaging Het
Mmp15 A T 8: 95,372,317 N591Y probably benign Het
Mrpl53 T C 6: 83,109,537 L74P probably damaging Het
Mvp C T 7: 126,989,865 V577M probably damaging Het
Neb T C 2: 52,249,376 K140E probably damaging Het
Nfya A G 17: 48,398,998 V48A possibly damaging Het
Ngf G T 3: 102,509,803 probably benign Het
Nipsnap3b C T 4: 53,017,088 A104V possibly damaging Het
Nlrp14 A G 7: 107,182,721 Y375C probably benign Het
Nod1 A G 6: 54,938,217 Y764H probably damaging Het
Olfr225 G A 11: 59,613,494 V177M probably damaging Het
Olfr270 A T 4: 52,971,232 I204F probably benign Het
Olfr873 T G 9: 20,301,091 M297R probably damaging Het
Pcdhb19 A T 18: 37,497,182 Q10L probably benign Het
Pdcl T C 2: 37,352,130 I203V probably benign Het
Peg10 C A 6: 4,755,711 R96S possibly damaging Het
Pknox1 T A 17: 31,604,790 N379K probably benign Het
Prodh T G 16: 18,077,813 Q360P probably damaging Het
Raf1 C T 6: 115,632,973 G202S probably benign Het
Rgs11 T A 17: 26,207,459 probably null Het
Rilp A T 11: 75,510,233 H29L probably damaging Het
Rtel1 T C 2: 181,321,046 C31R probably damaging Het
Rubcnl T A 14: 75,042,458 I427K probably damaging Het
Ryr1 C A 7: 29,052,035 R3706L probably damaging Het
Ryr2 T C 13: 11,714,548 D2396G probably damaging Het
Slc45a2 T C 15: 11,025,868 S435P probably damaging Het
Spata17 A G 1: 187,112,601 V111A probably damaging Het
Svep1 C T 4: 58,116,608 D881N possibly damaging Het
Sypl2 T A 3: 108,219,095 N67I possibly damaging Het
Tenm3 T C 8: 48,236,720 Y1944C probably damaging Het
Tep1 A T 14: 50,824,789 D2535E possibly damaging Het
Tkt T A 14: 30,572,220 I529N probably damaging Het
Trp53i11 T G 2: 93,197,735 V39G probably damaging Het
Trpm2 C T 10: 77,925,825 G997D probably damaging Het
Usp3 A G 9: 66,540,167 V219A possibly damaging Het
Usp4 T A 9: 108,391,671 probably null Het
Wdfy3 A G 5: 101,917,411 V1297A probably benign Het
Wdr46 T A 17: 33,941,023 F70I probably benign Het
Xkr6 T C 14: 63,819,549 V303A unknown Het
Zdbf2 C T 1: 63,304,006 Q515* probably null Het
Zfhx2 A G 14: 55,072,897 Y731H possibly damaging Het
Other mutations in Ctcfl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Ctcfl APN 2 173094734 missense possibly damaging 0.82
IGL01418:Ctcfl APN 2 173118331 missense probably benign 0.03
IGL01524:Ctcfl APN 2 173117384 missense probably benign 0.08
IGL02610:Ctcfl APN 2 173106026 splice site probably benign
IGL02961:Ctcfl APN 2 173101919 missense possibly damaging 0.70
R0147:Ctcfl UTSW 2 173118547 missense possibly damaging 0.75
R0362:Ctcfl UTSW 2 173118443 missense probably damaging 0.99
R1099:Ctcfl UTSW 2 173112360 missense probably damaging 1.00
R1540:Ctcfl UTSW 2 173112348 missense probably benign 0.36
R1892:Ctcfl UTSW 2 173118685 missense probably benign 0.24
R2036:Ctcfl UTSW 2 173101985 missense possibly damaging 0.95
R2060:Ctcfl UTSW 2 173118506 missense probably benign 0.00
R2925:Ctcfl UTSW 2 173094696 missense probably damaging 1.00
R4327:Ctcfl UTSW 2 173113506 intron probably benign
R4837:Ctcfl UTSW 2 173113656 missense probably benign 0.00
R4894:Ctcfl UTSW 2 173117403 missense probably benign 0.19
R4909:Ctcfl UTSW 2 173095398 missense probably benign 0.42
R5128:Ctcfl UTSW 2 173117396 missense probably benign 0.00
R5247:Ctcfl UTSW 2 173113609 missense probably damaging 1.00
R6263:Ctcfl UTSW 2 173095337 missense probably benign 0.00
R6768:Ctcfl UTSW 2 173117291 missense possibly damaging 0.84
R7045:Ctcfl UTSW 2 173112374 missense probably damaging 1.00
R7180:Ctcfl UTSW 2 173105977 intron probably null
R7256:Ctcfl UTSW 2 173118475 missense probably benign 0.01
R7268:Ctcfl UTSW 2 173107795 missense probably benign 0.26
R7378:Ctcfl UTSW 2 173112258 missense probably damaging 1.00
R7560:Ctcfl UTSW 2 173118406 missense probably damaging 0.96
R7657:Ctcfl UTSW 2 173113656 missense possibly damaging 0.71
R7733:Ctcfl UTSW 2 173117192 missense probably benign
R8022:Ctcfl UTSW 2 173118766 missense not run
R8038:Ctcfl UTSW 2 173101905 missense not run
Z1088:Ctcfl UTSW 2 173118344 missense probably benign 0.01
Z1177:Ctcfl UTSW 2 173102036 missense not run
Predicted Primers PCR Primer
(F):5'- TCACGCAATGCTGAAGGCTGAG -3'
(R):5'- TCTGCACCCCATAAAGATTGCACG -3'

Sequencing Primer
(F):5'- CTGAAGGCTGAGCTGGG -3'
(R):5'- TGGGTACTTCACCCAGATCAAAG -3'
Posted On2013-07-24