Mutagenetix > Incidental Mutations

Incidental Mutation 'R0148:Lama5'

60859

Institutional Source

Beutler Lab

Gene Symbol

Lama5

Ensembl Gene

ENSMUSG00000015647

Gene Name

laminin, alpha 5

Synonyms

MMRRC Submission

038432-MU

Accession Numbers

Ncbi RefSeq: NM_001081171.2; MGI: 105382

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0148 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

180176373-180225859 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 180190406 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 1714 (H1714R)

Ref Sequence

ENSEMBL: ENSMUSP00000015791 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015791]

PDB Structure

LAMININ ALPHA5 CHAIN N-TERMINAL FRAGMENT [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000015791
AA Change: H1714R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000015791
Gene: ENSMUSG00000015647
AA Change: H1714R

Domain	Start	End	E-Value	Type
signal peptide	1	40	N/A	INTRINSIC
LamNT	44	303	1.06e-132	SMART
EGF_Lam	305	361	4.35e-6	SMART
EGF_Lam	364	431	5.78e-11	SMART
EGF_Lam	434	476	1.32e-5	SMART
EGF_Lam	500	544	8.63e-10	SMART
EGF_Lam	547	590	1.16e-10	SMART
EGF_Lam	593	635	4.63e-10	SMART
EGF_Lam	638	680	6.25e-7	SMART
EGF_Lam	683	726	3.1e-11	SMART
EGF_Lam	730	779	2.99e-4	SMART
EGF_Lam	782	831	4.66e-6	SMART
EGF_Lam	834	878	3.48e-5	SMART
low complexity region	1261	1273	N/A	INTRINSIC
EGF_Lam	1443	1486	7.01e-10	SMART
EGF_like	1489	1530	3.64e-1	SMART
EGF_Lam	1533	1579	8.56e-14	SMART
EGF_Lam	1582	1630	1.86e-14	SMART
LamB	1689	1819	5.86e-61	SMART
EGF_like	1818	1862	2.74e0	SMART
EGF_Lam	1865	1912	3.32e-11	SMART
EGF_Lam	1915	1968	1.61e-9	SMART
EGF_Lam	1971	2022	6.39e-13	SMART
EGF_Lam	2025	2069	1.94e-12	SMART
EGF_Lam	2072	2116	1.35e-11	SMART
EGF_like	2103	2145	3.1e1	SMART
EGF_Lam	2119	2166	1.18e-2	SMART
Pfam:Laminin_I	2189	2453	1.7e-65	PFAM
low complexity region	2532	2548	N/A	INTRINSIC
low complexity region	2557	2569	N/A	INTRINSIC
low complexity region	2632	2641	N/A	INTRINSIC
low complexity region	2663	2676	N/A	INTRINSIC
LamG	2760	2912	3.97e-8	SMART
LamG	2966	3103	1.78e-10	SMART
LamG	3149	3274	1.11e-20	SMART
LamG	3359	3497	4.05e-23	SMART
LamG	3539	3670	3e-26	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 96.0%
20x: 91.8%

Validation Efficiency

86% (30/35)

MGI Phenotype

Strain: 3624772; 1934917
Lethality: E1-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the vertebrate laminin alpha chains. Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. The protein encoded by this gene is the alpha-5 subunit of of laminin-10 (laminin-511), laminin-11 (laminin-521) and laminin-15 (laminin-523). [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit disrupted basal laminae leading to exencephaly, syndactyly, placentopathy, kidney defects, abnormal lobar septation with absence of a visceral pleural membrane, and lethality in late gestation. [provided by MGI curators]

Allele List at MGI

All alleles(49) : Targeted(5) Gene trapped(44)

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	C	6: 121,662,446		probably null	Het
Agtr1a	T	C	13: 30,381,944	S331P	probably benign	Het
Ank1	T	A	8: 23,123,977	N1545K	probably damaging	Het
Bahcc1	A	T	11: 120,268,404	Q152H	probably damaging	Het
Bend3	T	A	10: 43,511,950	Y780N	probably damaging	Het
Bod1l	G	T	5: 41,818,697	A1758E	possibly damaging	Het
Ctcfl	T	C	2: 173,118,547	D81G	possibly damaging	Het
Ddx39	C	T	8: 83,722,476	R298C	possibly damaging	Het
Dock8	T	C	19: 25,119,459	L577P	probably benign	Het
Drc1	A	T	5: 30,281,489	N13I	possibly damaging	Het
Efl1	T	C	7: 82,671,670	S104P	probably damaging	Het
Eml4	T	A	17: 83,421,652	N85K	probably damaging	Het
Epb41l4a	T	C	18: 33,798,800	T581A	probably damaging	Het
Epha3	T	C	16: 63,612,944	D446G	possibly damaging	Het
Fam209	G	T	2: 172,473,980	G92C	probably damaging	Het
Fbln1	G	A	15: 85,230,826	R193H	probably damaging	Het
Fbxw21	A	G	9: 109,148,017		probably null	Het
Fgf17	C	T	14: 70,638,873	R49Q	probably damaging	Het
Flnb	T	C	14: 7,939,077	S2307P	probably benign	Het
Galr1	A	G	18: 82,405,570	L194P	probably benign	Het
Gar1	T	C	3: 129,829,473	H89R	probably damaging	Het
Gbp4	T	A	5: 105,119,496	Y519F	probably benign	Het
Git1	A	G	11: 77,505,728	T601A	probably benign	Het
Gm10722	T	"C,A"	9: 3,001,405		probably null	Het
Gm5142	C	T	14: 59,178,670	R13H	possibly damaging	Het
Gria2	A	C	3: 80,707,731	W481G	probably damaging	Het
Homer2	T	C	7: 81,624,278	T57A	probably benign	Het
Hpse2	A	C	19: 42,931,660		probably null	Het
Hspb7	T	C	4: 141,423,991	I148T	probably damaging	Het
Htr1d	C	A	4: 136,443,477	T339K	probably damaging	Het
Il4ra	T	A	7: 125,575,537	C306S	probably damaging	Het
Kansl3	A	T	1: 36,353,816	C225S	probably damaging	Het
Lama3	G	A	18: 12,448,272	C596Y	probably damaging	Het
March6	C	T	15: 31,490,612	V293M	probably damaging	Het
Med12l	A	G	3: 59,037,654	D100G	probably damaging	Het
Mettl14	G	A	3: 123,371,394	T316I	probably damaging	Het
Mmp15	A	T	8: 95,372,317	N591Y	probably benign	Het
Mrpl53	T	C	6: 83,109,537	L74P	probably damaging	Het
Mvp	C	T	7: 126,989,865	V577M	probably damaging	Het
Neb	T	C	2: 52,249,376	K140E	probably damaging	Het
Nfya	A	G	17: 48,398,998	V48A	possibly damaging	Het
Ngf	G	T	3: 102,509,803		probably benign	Het
Nipsnap3b	C	T	4: 53,017,088	A104V	possibly damaging	Het
Nlrp14	A	G	7: 107,182,721	Y375C	probably benign	Het
Nod1	A	G	6: 54,938,217	Y764H	probably damaging	Het
Olfr225	G	A	11: 59,613,494	V177M	probably damaging	Het
Olfr270	A	T	4: 52,971,232	I204F	probably benign	Het
Olfr873	T	G	9: 20,301,091	M297R	probably damaging	Het
Pcdhb19	A	T	18: 37,497,182	Q10L	probably benign	Het
Pdcl	T	C	2: 37,352,130	I203V	probably benign	Het
Peg10	C	A	6: 4,755,711	R96S	possibly damaging	Het
Pknox1	T	A	17: 31,604,790	N379K	probably benign	Het
Prodh	T	G	16: 18,077,813	Q360P	probably damaging	Het
Raf1	C	T	6: 115,632,973	G202S	probably benign	Het
Rgs11	T	A	17: 26,207,459		probably null	Het
Rilp	A	T	11: 75,510,233	H29L	probably damaging	Het
Rtel1	T	C	2: 181,321,046	C31R	probably damaging	Het
Rubcnl	T	A	14: 75,042,458	I427K	probably damaging	Het
Ryr1	C	A	7: 29,052,035	R3706L	probably damaging	Het
Ryr2	T	C	13: 11,714,548	D2396G	probably damaging	Het
Slc45a2	T	C	15: 11,025,868	S435P	probably damaging	Het
Spata17	A	G	1: 187,112,601	V111A	probably damaging	Het
Svep1	C	T	4: 58,116,608	D881N	possibly damaging	Het
Sypl2	T	A	3: 108,219,095	N67I	possibly damaging	Het
Tenm3	T	C	8: 48,236,720	Y1944C	probably damaging	Het
Tep1	A	T	14: 50,824,789	D2535E	possibly damaging	Het
Tkt	T	A	14: 30,572,220	I529N	probably damaging	Het
Trp53i11	T	G	2: 93,197,735	V39G	probably damaging	Het
Trpm2	C	T	10: 77,925,825	G997D	probably damaging	Het
Usp3	A	G	9: 66,540,167	V219A	possibly damaging	Het
Usp4	T	A	9: 108,391,671		probably null	Het
Wdfy3	A	G	5: 101,917,411	V1297A	probably benign	Het
Wdr46	T	A	17: 33,941,023	F70I	probably benign	Het
Xkr6	T	C	14: 63,819,549	V303A	unknown	Het
Zdbf2	C	T	1: 63,304,006	Q515*	probably null	Het
Zfhx2	A	G	14: 55,072,897	Y731H	possibly damaging	Het

Other mutations in Lama5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01067:Lama5	APN	2	180176543	unclassified	probably benign
IGL01370:Lama5	APN	2	180197400	missense	possibly damaging	0.87
IGL01474:Lama5	APN	2	180196570	missense	probably damaging	1.00
IGL01614:Lama5	APN	2	180180864	missense	probably damaging	1.00
IGL01941:Lama5	APN	2	180192392	missense	possibly damaging	0.71
IGL01953:Lama5	APN	2	180190704	missense	probably damaging	0.97
IGL02093:Lama5	APN	2	180188587	missense	probably damaging	1.00
IGL02197:Lama5	APN	2	180207219	missense	possibly damaging	0.82
IGL02308:Lama5	APN	2	180190327	splice site	probably benign
IGL02314:Lama5	APN	2	180194482	splice site	probably benign
IGL02317:Lama5	APN	2	180191319	missense	probably damaging	1.00
IGL02354:Lama5	APN	2	180193884	nonsense	probably null
IGL02361:Lama5	APN	2	180193884	nonsense	probably null
IGL02557:Lama5	APN	2	180190932	nonsense	probably null
IGL03026:Lama5	APN	2	180195967	missense	probably benign	0.34
IGL03160:Lama5	APN	2	180180335	missense	probably damaging	1.00
IGL03238:Lama5	APN	2	180188574	missense	probably benign
IGL03390:Lama5	APN	2	180207218	missense	probably damaging	1.00
Salty	UTSW	2	180181651	missense	possibly damaging	0.84
PIT4378001:Lama5	UTSW	2	180189445	missense	possibly damaging	0.89
R0003:Lama5	UTSW	2	180178079	splice site	probably null
R0056:Lama5	UTSW	2	180187106	intron	probably benign
R0147:Lama5	UTSW	2	180190406	missense	probably benign
R0310:Lama5	UTSW	2	180181566	splice site	probably benign
R0326:Lama5	UTSW	2	180182426	missense	possibly damaging	0.90
R0368:Lama5	UTSW	2	180181230	nonsense	probably null
R0479:Lama5	UTSW	2	180184457	missense	probably benign	0.03
R0490:Lama5	UTSW	2	180180169	missense	possibly damaging	0.90
R0636:Lama5	UTSW	2	180189331	critical splice donor site	probably null
R0704:Lama5	UTSW	2	180179484	missense	possibly damaging	0.84
R0733:Lama5	UTSW	2	180180718	missense	possibly damaging	0.83
R1017:Lama5	UTSW	2	180195420	missense	probably damaging	1.00
R1078:Lama5	UTSW	2	180179764	unclassified	probably benign
R1294:Lama5	UTSW	2	180190921	missense	probably benign	0.00
R1423:Lama5	UTSW	2	180195641	missense	probably damaging	1.00
R1438:Lama5	UTSW	2	180182800	missense	probably benign	0.01
R1447:Lama5	UTSW	2	180185878	missense	probably damaging	0.99
R1540:Lama5	UTSW	2	180180151	missense	probably benign
R1601:Lama5	UTSW	2	180197745	missense	probably damaging	1.00
R1624:Lama5	UTSW	2	180206758	missense	probably benign	0.02
R1674:Lama5	UTSW	2	180201987	missense	probably benign	0.00
R1687:Lama5	UTSW	2	180194066	missense	probably benign	0.00
R1696:Lama5	UTSW	2	180202486	missense	probably damaging	1.00
R1701:Lama5	UTSW	2	180221369	missense	probably damaging	1.00
R1778:Lama5	UTSW	2	180195481	splice site	probably benign
R1936:Lama5	UTSW	2	180190921	missense	probably benign	0.00
R1939:Lama5	UTSW	2	180190921	missense	probably benign	0.00
R1940:Lama5	UTSW	2	180190921	missense	probably benign	0.00
R1953:Lama5	UTSW	2	180190747	missense	possibly damaging	0.94
R1966:Lama5	UTSW	2	180188352	missense	probably damaging	1.00
R2024:Lama5	UTSW	2	180179130	missense	probably benign	0.00
R2079:Lama5	UTSW	2	180225508	missense	possibly damaging	0.68
R2115:Lama5	UTSW	2	180186885	missense	probably damaging	1.00
R2173:Lama5	UTSW	2	180196242	missense	probably benign	0.00
R2272:Lama5	UTSW	2	180178603	missense	possibly damaging	0.93
R2357:Lama5	UTSW	2	180180097	missense	probably benign	0.01
R2860:Lama5	UTSW	2	180187247	missense	probably benign	0.00
R2861:Lama5	UTSW	2	180187247	missense	probably benign	0.00
R2939:Lama5	UTSW	2	180198954	missense	probably damaging	1.00
R3053:Lama5	UTSW	2	180183067	missense	probably damaging	0.99
R3430:Lama5	UTSW	2	180196317	missense	probably benign	0.00
R3752:Lama5	UTSW	2	180187222	missense	probably damaging	1.00
R3782:Lama5	UTSW	2	180194563	missense	possibly damaging	0.57
R3901:Lama5	UTSW	2	180182351	splice site	probably benign
R4248:Lama5	UTSW	2	180180427	missense	possibly damaging	0.84
R4626:Lama5	UTSW	2	180184460	missense	probably damaging	0.98
R4638:Lama5	UTSW	2	180190413	missense	possibly damaging	0.89
R4669:Lama5	UTSW	2	180180637	missense	probably damaging	1.00
R4673:Lama5	UTSW	2	180199266	missense	probably damaging	1.00
R4677:Lama5	UTSW	2	180179366	missense	possibly damaging	0.69
R4701:Lama5	UTSW	2	180191696	missense	probably damaging	1.00
R4774:Lama5	UTSW	2	180185941	missense	probably damaging	1.00
R4880:Lama5	UTSW	2	180177068	unclassified	probably benign
R4923:Lama5	UTSW	2	180184149	missense	probably benign	0.18
R4960:Lama5	UTSW	2	180208252	critical splice donor site	probably null
R4983:Lama5	UTSW	2	180193449	missense	probably benign	0.13
R5061:Lama5	UTSW	2	180198786	nonsense	probably null
R5080:Lama5	UTSW	2	180207200	nonsense	probably null
R5135:Lama5	UTSW	2	180202220	missense	possibly damaging	0.89
R5206:Lama5	UTSW	2	180191304	missense	probably damaging	1.00
R5296:Lama5	UTSW	2	180193801	missense	probably damaging	1.00
R5319:Lama5	UTSW	2	180181118	missense	probably damaging	1.00
R5355:Lama5	UTSW	2	180181651	missense	possibly damaging	0.84
R5388:Lama5	UTSW	2	180190746	missense	possibly damaging	0.83
R5528:Lama5	UTSW	2	180194563	missense	probably benign	0.21
R5536:Lama5	UTSW	2	180189349	missense	probably damaging	0.99
R5658:Lama5	UTSW	2	180208276	nonsense	probably null
R5823:Lama5	UTSW	2	180192492	missense	probably benign	0.04
R5885:Lama5	UTSW	2	180201831	missense	probably damaging	1.00
R5889:Lama5	UTSW	2	180193674	intron	probably benign
R5912:Lama5	UTSW	2	180195475	missense	probably damaging	1.00
R5955:Lama5	UTSW	2	180197474	missense	probably damaging	1.00
R6015:Lama5	UTSW	2	180185392	missense	probably benign	0.36
R6037:Lama5	UTSW	2	180207013	missense	probably damaging	1.00
R6037:Lama5	UTSW	2	180207013	missense	probably damaging	1.00
R6191:Lama5	UTSW	2	180180611	missense	probably damaging	0.98
R6191:Lama5	UTSW	2	180185959	missense	probably damaging	1.00
R6359:Lama5	UTSW	2	180195982	missense	probably benign	0.01
R6385:Lama5	UTSW	2	180196533	missense	probably damaging	1.00
R6406:Lama5	UTSW	2	180197464	nonsense	probably null
R6552:Lama5	UTSW	2	180181154	missense	probably damaging	0.98
R6632:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6633:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6645:Lama5	UTSW	2	180179670	missense	probably damaging	1.00
R6731:Lama5	UTSW	2	180188574	missense	probably benign	0.09
R6744:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6798:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6799:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6801:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6851:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6869:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6881:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6882:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6884:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R7022:Lama5	UTSW	2	180180731	missense	probably damaging	1.00
R7204:Lama5	UTSW	2	180202177	missense	probably damaging	1.00
R7207:Lama5	UTSW	2	180207084	missense	probably damaging	0.98
R7282:Lama5	UTSW	2	180201795	missense	probably damaging	1.00
R7367:Lama5	UTSW	2	180192958	missense	probably benign	0.01
R7410:Lama5	UTSW	2	180202390	critical splice donor site	probably null
R7699:Lama5	UTSW	2	180180861	missense	probably damaging	1.00
R7849:Lama5	UTSW	2	180201812	missense	probably damaging	1.00
R7909:Lama5	UTSW	2	180192276	missense	possibly damaging	0.95
R7948:Lama5	UTSW	2	180202201	missense	probably damaging	1.00
R8153:Lama5	UTSW	2	180187931	missense	probably benign	0.37
R8317:Lama5	UTSW	2	180206991	missense	probably damaging	1.00
R8351:Lama5	UTSW	2	180195608	missense	probably damaging	1.00
R8370:Lama5	UTSW	2	180201487	missense	possibly damaging	0.80
R8398:Lama5	UTSW	2	180197034	critical splice donor site	probably null
R8401:Lama5	UTSW	2	180198787	missense	probably damaging	1.00
R8404:Lama5	UTSW	2	180195222	missense	probably damaging	1.00
R8502:Lama5	UTSW	2	180195222	missense	probably damaging	1.00
R8732:Lama5	UTSW	2	180186688	missense	not run
R8755:Lama5	UTSW	2	180190921	missense	probably benign	0.00
RF020:Lama5	UTSW	2	180196178	missense	probably benign
X0065:Lama5	UTSW	2	180181731	missense	probably benign	0.26
Z1177:Lama5	UTSW	2	180183630	missense	probably benign	0.03
Z1177:Lama5	UTSW	2	180189419	missense	probably damaging	1.00
Z1177:Lama5	UTSW	2	180190714	missense	possibly damaging	0.95
Z1177:Lama5	UTSW	2	180198810	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAGGAAGGCGATGCTCATTTG -3'
(R):5'- TTGTACTCTGAGGGGAGGAAGCAC -3'

Sequencing Primer
(F):5'- CATTTGGTTGCCCTGAGAAC -3'
(R):5'- GGGAGGAAGCACCCTGG -3'

Posted On

2013-07-24