Incidental Mutation 'R7878:Cntn1'
ID608597
Institutional Source Beutler Lab
Gene Symbol Cntn1
Ensembl Gene ENSMUSG00000055022
Gene Namecontactin 1
SynonymsCNTN, F3cam
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7878 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location92051165-92341967 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92295053 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 679 (Y679H)
Ref Sequence ENSEMBL: ENSMUSP00000000109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000109] [ENSMUST00000068378] [ENSMUST00000169825]
Predicted Effect probably damaging
Transcript: ENSMUST00000000109
AA Change: Y679H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000109
Gene: ENSMUSG00000055022
AA Change: Y679H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 56 121 4.07e-4 SMART
IG 143 232 1.25e-4 SMART
IGc2 254 317 1.24e-17 SMART
IGc2 343 398 4.22e-11 SMART
IGc2 427 491 2.52e-9 SMART
IG 511 603 3.51e-8 SMART
FN3 606 692 6.69e-12 SMART
FN3 709 795 1.17e-2 SMART
FN3 811 892 1.16e-6 SMART
FN3 907 987 2.46e-1 SMART
low complexity region 995 1018 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068378
AA Change: Y679H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067842
Gene: ENSMUSG00000055022
AA Change: Y679H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 56 121 4.07e-4 SMART
IG 143 232 1.25e-4 SMART
IGc2 254 317 1.24e-17 SMART
IGc2 343 398 4.22e-11 SMART
IGc2 427 491 2.52e-9 SMART
IG 511 603 3.51e-8 SMART
FN3 606 692 6.69e-12 SMART
FN3 709 795 1.17e-2 SMART
FN3 811 892 1.16e-6 SMART
FN3 907 987 2.46e-1 SMART
low complexity region 995 1018 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169825
AA Change: Y679H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133063
Gene: ENSMUSG00000055022
AA Change: Y679H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 56 121 4.07e-4 SMART
IG 143 232 1.25e-4 SMART
IGc2 254 317 1.24e-17 SMART
IGc2 343 398 4.22e-11 SMART
IGc2 427 491 2.52e-9 SMART
IG 511 603 3.51e-8 SMART
FN3 606 692 6.69e-12 SMART
FN3 709 795 1.17e-2 SMART
FN3 811 892 1.16e-6 SMART
FN3 907 987 2.46e-1 SMART
low complexity region 995 1018 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mutations of this gene result in growth retardation, progressive ataxia and death prior to weaning. A targeted null mutation, but not a spontaneous mutation, causes a small cerebellum with abnormalities of the molecular layer and abnormal Purkinje cellaxon morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,284,022 R4385W probably benign Het
Ahi1 G A 10: 20,981,431 probably null Het
Ak7 T A 12: 105,766,749 I584N probably damaging Het
Akip1 A T 7: 109,707,402 Y102F probably damaging Het
Alg9 T C 9: 50,842,783 Y588H probably benign Het
Arid1a A T 4: 133,687,271 N831K unknown Het
Armc4 G T 18: 7,217,801 H638N probably benign Het
Bcl2l11 T A 2: 128,128,688 L19* probably null Het
Btn1a1 T C 13: 23,459,044 T412A possibly damaging Het
Ccbe1 T C 18: 66,076,391 N193D possibly damaging Het
Ccdc114 A G 7: 45,924,560 E17G possibly damaging Het
Cd96 A G 16: 46,117,776 S109P probably damaging Het
Cdh23 A C 10: 60,314,200 I2622S possibly damaging Het
Cmya5 G T 13: 93,089,757 T2941K probably damaging Het
Cpsf1 A G 15: 76,600,500 V619A probably damaging Het
Elp5 T A 11: 69,970,599 I185F probably damaging Het
Frem1 A G 4: 83,020,680 V55A probably benign Het
Gm8251 T C 1: 44,056,014 S1975G probably benign Het
Kif1b A T 4: 149,214,997 Y985N probably damaging Het
Lao1 A G 4: 118,967,422 N234D probably benign Het
Lima1 C T 15: 99,819,550 V192I probably benign Het
Lrp2 T G 2: 69,507,809 D1209A probably damaging Het
Lrp2 C A 2: 69,507,810 D1209Y probably damaging Het
Luzp1 A G 4: 136,541,852 H462R probably benign Het
Mab21l1 A T 3: 55,784,017 T342S probably benign Het
Mst1 T C 9: 108,084,613 V657A probably benign Het
Mtmr11 A G 3: 96,169,199 K490R probably benign Het
Myh3 A G 11: 67,087,251 D383G probably damaging Het
Nectin1 G A 9: 43,803,901 G478D probably benign Het
Nrip1 A G 16: 76,294,666 M1T probably null Het
Olfr338 A G 2: 36,377,133 D119G probably damaging Het
Olfr625-ps1 A T 7: 103,683,264 H182L probably damaging Het
Pnisr C A 4: 21,874,370 F704L unknown Het
Ptpn21 T A 12: 98,715,128 K82N probably damaging Het
Pyroxd2 T G 19: 42,742,665 probably null Het
Pzp A G 6: 128,512,311 S446P possibly damaging Het
Rbck1 T A 2: 152,318,410 I450F probably damaging Het
Rnase4 T A 14: 51,104,876 L19Q probably damaging Het
Rrp9 A G 9: 106,481,317 E118G probably damaging Het
Sec22a A G 16: 35,347,635 S169P probably benign Het
Sema5b G A 16: 35,661,626 S957N probably benign Het
Serpina3g A T 12: 104,238,102 probably benign Het
Skint2 A T 4: 112,649,745 I322F possibly damaging Het
Sspo G A 6: 48,492,526 C4471Y probably damaging Het
Stk16 T A 1: 75,212,945 L167* probably null Het
Tanc2 G A 11: 105,913,415 R245H Het
Tdpoz1 G A 3: 93,671,124 Q118* probably null Het
Tekt3 C T 11: 63,070,451 R149* probably null Het
Tenm4 A G 7: 96,852,357 E1256G probably damaging Het
Tie1 G A 4: 118,478,424 R791C probably damaging Het
Tpr T A 1: 150,423,660 S1204T possibly damaging Het
Trim28 G T 7: 13,024,362 probably benign Het
Ucp1 A G 8: 83,297,892 N282S probably benign Het
Unc80 T A 1: 66,601,141 D1402E possibly damaging Het
Vmn1r69 T A 7: 10,580,790 T5S probably benign Het
Zfyve28 T A 5: 34,199,655 K733M probably damaging Het
Other mutations in Cntn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Cntn1 APN 15 92250877 missense possibly damaging 0.92
IGL01109:Cntn1 APN 15 92339577 nonsense probably null
IGL01399:Cntn1 APN 15 92305144 missense probably damaging 1.00
IGL01714:Cntn1 APN 15 92253989 nonsense probably null
IGL02052:Cntn1 APN 15 92291703 missense possibly damaging 0.95
IGL02342:Cntn1 APN 15 92246017 missense probably benign 0.01
IGL02507:Cntn1 APN 15 92250979 missense possibly damaging 0.92
IGL02511:Cntn1 APN 15 92216385 start gained probably benign
IGL02702:Cntn1 APN 15 92291601 splice site probably benign
IGL02927:Cntn1 APN 15 92291680 missense probably benign 0.12
IGL02948:Cntn1 APN 15 92246010 missense probably benign 0.01
R0035:Cntn1 UTSW 15 92232088 splice site probably benign
R0084:Cntn1 UTSW 15 92317917 missense probably benign 0.01
R0346:Cntn1 UTSW 15 92232087 splice site probably benign
R0634:Cntn1 UTSW 15 92314563 nonsense probably null
R1348:Cntn1 UTSW 15 92314663 missense probably damaging 1.00
R1613:Cntn1 UTSW 15 92245990 missense possibly damaging 0.60
R1793:Cntn1 UTSW 15 92291671 missense possibly damaging 0.92
R1815:Cntn1 UTSW 15 92250948 missense probably benign 0.00
R1851:Cntn1 UTSW 15 92305140 missense probably damaging 1.00
R1852:Cntn1 UTSW 15 92305140 missense probably damaging 1.00
R2068:Cntn1 UTSW 15 92318062 missense possibly damaging 0.82
R2269:Cntn1 UTSW 15 92294982 splice site probably benign
R4394:Cntn1 UTSW 15 92291764 missense probably damaging 1.00
R4667:Cntn1 UTSW 15 92295079 missense probably damaging 1.00
R4771:Cntn1 UTSW 15 92305091 missense possibly damaging 0.82
R4944:Cntn1 UTSW 15 92228668 missense probably damaging 1.00
R5044:Cntn1 UTSW 15 92242995 missense probably damaging 1.00
R5218:Cntn1 UTSW 15 92339549 missense unknown
R5314:Cntn1 UTSW 15 92295011 missense probably benign 0.01
R5445:Cntn1 UTSW 15 92295077 missense probably damaging 1.00
R5518:Cntn1 UTSW 15 92314653 missense probably benign 0.00
R6849:Cntn1 UTSW 15 92305246 missense probably damaging 0.99
R6885:Cntn1 UTSW 15 92243099 critical splice donor site probably null
R7035:Cntn1 UTSW 15 92314511 missense probably benign 0.04
R7070:Cntn1 UTSW 15 92254036 missense probably damaging 1.00
R7287:Cntn1 UTSW 15 92245952 splice site probably null
R7311:Cntn1 UTSW 15 92232275 critical splice donor site probably null
R7401:Cntn1 UTSW 15 92317989 missense probably benign
R7484:Cntn1 UTSW 15 92254041 missense probably benign 0.00
R7492:Cntn1 UTSW 15 92314542 missense probably benign
R7617:Cntn1 UTSW 15 92246089 missense probably damaging 1.00
R7644:Cntn1 UTSW 15 92310009 missense probably benign 0.14
R8354:Cntn1 UTSW 15 92232249 missense probably benign
R8454:Cntn1 UTSW 15 92232249 missense probably benign
R8465:Cntn1 UTSW 15 92339523 frame shift probably null
R8757:Cntn1 UTSW 15 92255920 missense possibly damaging 0.90
R8759:Cntn1 UTSW 15 92255920 missense possibly damaging 0.90
R8767:Cntn1 UTSW 15 92234466 missense probably damaging 1.00
R8768:Cntn1 UTSW 15 92234466 missense probably damaging 1.00
Z1177:Cntn1 UTSW 15 92309970 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAGCATTTGTCACTGCTAG -3'
(R):5'- ACATAGTCTCTGGTGTAATGTGCTG -3'

Sequencing Primer
(F):5'- AGCATTTGTCACTGCTAGATTTTC -3'
(R):5'- TCTAGATGAGCCACTAATTGCAGAG -3'
Posted On2019-12-20