Incidental Mutation 'R7878:Cd96'
ID608601
Institutional Source Beutler Lab
Gene Symbol Cd96
Ensembl Gene ENSMUSG00000022657
Gene NameCD96 antigen
Synonyms1700109I12Rik, Tactile
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7878 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location46035657-46120251 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46117776 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 109 (S109P)
Ref Sequence ENSEMBL: ENSMUSP00000023336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023336]
Predicted Effect probably damaging
Transcript: ENSMUST00000023336
AA Change: S109P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023336
Gene: ENSMUSG00000022657
AA Change: S109P

DomainStartEndE-ValueType
IG 30 137 1.63e-3 SMART
IG 145 247 1.12e-1 SMART
Blast:IG_like 257 357 3e-14 BLAST
low complexity region 434 448 N/A INTRINSIC
transmembrane domain 535 557 N/A INTRINSIC
low complexity region 571 580 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the immunoglobulin superfamily. It is a type I membrane protein. The protein may play a role in the adhesive interactions of activated T and NK cells during the late phase of the immune response. It may also function in antigen presentation. Alternative splicing generates multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,284,022 R4385W probably benign Het
Ahi1 G A 10: 20,981,431 probably null Het
Ak7 T A 12: 105,766,749 I584N probably damaging Het
Akip1 A T 7: 109,707,402 Y102F probably damaging Het
Alg9 T C 9: 50,842,783 Y588H probably benign Het
Arid1a A T 4: 133,687,271 N831K unknown Het
Armc4 G T 18: 7,217,801 H638N probably benign Het
Bcl2l11 T A 2: 128,128,688 L19* probably null Het
Btn1a1 T C 13: 23,459,044 T412A possibly damaging Het
Ccbe1 T C 18: 66,076,391 N193D possibly damaging Het
Ccdc114 A G 7: 45,924,560 E17G possibly damaging Het
Cdh23 A C 10: 60,314,200 I2622S possibly damaging Het
Cmya5 G T 13: 93,089,757 T2941K probably damaging Het
Cntn1 T C 15: 92,295,053 Y679H probably damaging Het
Cpsf1 A G 15: 76,600,500 V619A probably damaging Het
Elp5 T A 11: 69,970,599 I185F probably damaging Het
Frem1 A G 4: 83,020,680 V55A probably benign Het
Gm8251 T C 1: 44,056,014 S1975G probably benign Het
Kif1b A T 4: 149,214,997 Y985N probably damaging Het
Lao1 A G 4: 118,967,422 N234D probably benign Het
Lima1 C T 15: 99,819,550 V192I probably benign Het
Lrp2 T G 2: 69,507,809 D1209A probably damaging Het
Lrp2 C A 2: 69,507,810 D1209Y probably damaging Het
Luzp1 A G 4: 136,541,852 H462R probably benign Het
Mab21l1 A T 3: 55,784,017 T342S probably benign Het
Mst1 T C 9: 108,084,613 V657A probably benign Het
Mtmr11 A G 3: 96,169,199 K490R probably benign Het
Myh3 A G 11: 67,087,251 D383G probably damaging Het
Nectin1 G A 9: 43,803,901 G478D probably benign Het
Nrip1 A G 16: 76,294,666 M1T probably null Het
Olfr338 A G 2: 36,377,133 D119G probably damaging Het
Olfr625-ps1 A T 7: 103,683,264 H182L probably damaging Het
Pnisr C A 4: 21,874,370 F704L unknown Het
Ptpn21 T A 12: 98,715,128 K82N probably damaging Het
Pyroxd2 T G 19: 42,742,665 probably null Het
Pzp A G 6: 128,512,311 S446P possibly damaging Het
Rbck1 T A 2: 152,318,410 I450F probably damaging Het
Rnase4 T A 14: 51,104,876 L19Q probably damaging Het
Rrp9 A G 9: 106,481,317 E118G probably damaging Het
Sec22a A G 16: 35,347,635 S169P probably benign Het
Sema5b G A 16: 35,661,626 S957N probably benign Het
Serpina3g A T 12: 104,238,102 probably benign Het
Skint2 A T 4: 112,649,745 I322F possibly damaging Het
Sspo G A 6: 48,492,526 C4471Y probably damaging Het
Stk16 T A 1: 75,212,945 L167* probably null Het
Tanc2 G A 11: 105,913,415 R245H Het
Tdpoz1 G A 3: 93,671,124 Q118* probably null Het
Tekt3 C T 11: 63,070,451 R149* probably null Het
Tenm4 A G 7: 96,852,357 E1256G probably damaging Het
Tie1 G A 4: 118,478,424 R791C probably damaging Het
Tpr T A 1: 150,423,660 S1204T possibly damaging Het
Trim28 G T 7: 13,024,362 probably benign Het
Ucp1 A G 8: 83,297,892 N282S probably benign Het
Unc80 T A 1: 66,601,141 D1402E possibly damaging Het
Vmn1r69 T A 7: 10,580,790 T5S probably benign Het
Zfyve28 T A 5: 34,199,655 K733M probably damaging Het
Other mutations in Cd96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Cd96 APN 16 46071799 missense possibly damaging 0.85
IGL00588:Cd96 APN 16 46038554 missense probably benign 0.04
IGL00916:Cd96 APN 16 46041312 missense probably benign 0.07
IGL01080:Cd96 APN 16 46049693 missense possibly damaging 0.67
IGL01538:Cd96 APN 16 46109127 missense possibly damaging 0.67
IGL02350:Cd96 APN 16 46069776 splice site probably benign
IGL02357:Cd96 APN 16 46069776 splice site probably benign
IGL02892:Cd96 APN 16 46049797 critical splice acceptor site probably null
R0119:Cd96 UTSW 16 46038579 splice site probably benign
R0242:Cd96 UTSW 16 46071766 missense possibly damaging 0.88
R0242:Cd96 UTSW 16 46071766 missense possibly damaging 0.88
R0515:Cd96 UTSW 16 46063905 splice site probably benign
R0655:Cd96 UTSW 16 46099119 missense probably benign 0.06
R0684:Cd96 UTSW 16 46117790 missense possibly damaging 0.96
R0838:Cd96 UTSW 16 46117926 missense probably damaging 1.00
R1531:Cd96 UTSW 16 46117806 missense probably benign 0.03
R1664:Cd96 UTSW 16 46118001 missense possibly damaging 0.95
R1791:Cd96 UTSW 16 46117999 nonsense probably null
R1840:Cd96 UTSW 16 46099092 missense probably benign 0.36
R1873:Cd96 UTSW 16 46117972 missense probably damaging 1.00
R2895:Cd96 UTSW 16 46117805 missense probably benign 0.43
R2906:Cd96 UTSW 16 46051487 missense possibly damaging 0.56
R4291:Cd96 UTSW 16 46071749 missense probably damaging 0.98
R5112:Cd96 UTSW 16 46098938 missense probably benign
R5261:Cd96 UTSW 16 46069653 missense probably benign 0.39
R5274:Cd96 UTSW 16 46069703 missense possibly damaging 0.78
R5934:Cd96 UTSW 16 46117903 missense probably benign 0.43
R6002:Cd96 UTSW 16 46117986 missense possibly damaging 0.61
R6758:Cd96 UTSW 16 46118004 missense possibly damaging 0.50
R6992:Cd96 UTSW 16 46049724 missense possibly damaging 0.65
R7239:Cd96 UTSW 16 46109114 missense probably damaging 1.00
R7308:Cd96 UTSW 16 46071734 critical splice donor site probably null
R7316:Cd96 UTSW 16 46069653 missense probably benign 0.39
R7355:Cd96 UTSW 16 46041292 missense possibly damaging 0.51
R7553:Cd96 UTSW 16 46052021 missense probably damaging 1.00
R7921:Cd96 UTSW 16 46038480 frame shift probably null
R8924:Cd96 UTSW 16 46099022 missense probably damaging 1.00
X0017:Cd96 UTSW 16 46049774 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCAAATGTAGACAGTGTCTGCTG -3'
(R):5'- GTTCTGACATCAACTTGACCTGC -3'

Sequencing Primer
(F):5'- GCTGTCTTCGTGTATTCACTAAATG -3'
(R):5'- GGAGAAAAACTTCTTGGTACAGATGC -3'
Posted On2019-12-20