Incidental Mutation 'R7879:Hspa5'
ID608613
Institutional Source Beutler Lab
Gene Symbol Hspa5
Ensembl Gene ENSMUSG00000026864
Gene Nameheat shock protein 5
SynonymsBip, 78kDa, Sez7, Grp78, D2Wsu141e, D2Wsu17e, Hsce70, XAP-1 antigen, mBiP, baffled
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7879 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location34771970-34777547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34775929 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 595 (M595K)
Ref Sequence ENSEMBL: ENSMUSP00000028222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028222] [ENSMUST00000100171] [ENSMUST00000113086] [ENSMUST00000118108] [ENSMUST00000137145] [ENSMUST00000145903]
Predicted Effect probably benign
Transcript: ENSMUST00000028222
AA Change: M595K

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000028222
Gene: ENSMUSG00000026864
AA Change: M595K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:HSP70 31 637 8.2e-276 PFAM
Pfam:MreB_Mbl 136 406 1.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047963
SMART Domains Protein: ENSMUSP00000037746
Gene: ENSMUSG00000070953

DomainStartEndE-ValueType
Pfam:Kelch_2 5 51 6.7e-13 PFAM
Pfam:Kelch_4 5 58 2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100171
AA Change: M595K

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000097747
Gene: ENSMUSG00000026864
AA Change: M595K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:HSP70 31 637 3.3e-278 PFAM
Pfam:MreB_Mbl 136 406 1.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113086
SMART Domains Protein: ENSMUSP00000108709
Gene: ENSMUSG00000070953

DomainStartEndE-ValueType
Pfam:Kelch_2 30 82 5e-15 PFAM
Pfam:Kelch_4 30 86 6.7e-10 PFAM
Pfam:Kelch_3 47 96 1e-12 PFAM
Pfam:Kelch_4 87 140 4.6e-7 PFAM
Pfam:Kelch_3 98 150 1.6e-9 PFAM
Pfam:Kelch_5 138 174 6.2e-8 PFAM
Pfam:Kelch_1 141 186 8.3e-7 PFAM
Pfam:Kelch_4 141 190 2.3e-10 PFAM
Pfam:Kelch_6 141 190 4.1e-10 PFAM
Pfam:Kelch_3 151 200 3.5e-8 PFAM
Pfam:Kelch_5 188 225 1.8e-7 PFAM
Pfam:Kelch_1 191 233 2.8e-9 PFAM
Pfam:Kelch_4 193 240 9.4e-9 PFAM
Pfam:Kelch_3 201 250 6.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118108
SMART Domains Protein: ENSMUSP00000113099
Gene: ENSMUSG00000070953

DomainStartEndE-ValueType
Pfam:Kelch_2 30 82 2.8e-16 PFAM
Pfam:Kelch_4 30 82 3.7e-6 PFAM
Pfam:Kelch_3 99 147 8.2e-9 PFAM
Pfam:Kelch_4 138 191 2.7e-6 PFAM
Pfam:Kelch_3 149 201 7.9e-9 PFAM
Pfam:Kelch_5 189 225 2.8e-7 PFAM
Pfam:Kelch_1 192 237 5.2e-6 PFAM
Pfam:Kelch_4 192 241 1.3e-9 PFAM
Pfam:Kelch_6 192 241 2.4e-9 PFAM
Pfam:Kelch_3 202 251 1.7e-7 PFAM
Pfam:Kelch_5 239 276 8.1e-7 PFAM
Pfam:Kelch_1 242 284 1.8e-8 PFAM
Pfam:Kelch_4 244 291 5.5e-8 PFAM
Pfam:Kelch_3 252 301 3.2e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137145
Predicted Effect probably benign
Transcript: ENSMUST00000145903
SMART Domains Protein: ENSMUSP00000122360
Gene: ENSMUSG00000070953

DomainStartEndE-ValueType
Pfam:Kelch_2 38 90 1.5e-17 PFAM
Pfam:Kelch_4 38 90 2.2e-7 PFAM
Pfam:Kelch_1 55 87 4.5e-7 PFAM
Pfam:Kelch_3 107 155 7e-10 PFAM
Pfam:Kelch_4 146 199 4e-7 PFAM
Pfam:Kelch_3 157 209 1.5e-10 PFAM
Pfam:Kelch_5 197 231 1e-8 PFAM
Pfam:Kelch_4 200 249 3.4e-9 PFAM
Pfam:Kelch_5 247 284 5.1e-8 PFAM
Pfam:Kelch_1 250 292 2.9e-9 PFAM
Pfam:Kelch_6 250 301 1.2e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the heat shock protein 70 (HSP70) family. It is localized in the lumen of the endoplasmic reticulum (ER), and is involved in the folding and assembly of proteins in the ER. As this protein interacts with many ER proteins, it may play a key role in monitoring protein transport through the cell.[provided by RefSeq, Sep 2010]
PHENOTYPE: Nullizygous embryos die around implantation. Neonates homozygous for a knock-in allele die of respiratory failure. Mice homozygous for an ENU-induced mutation exhibit abnormal thalamocortical axon patterning, small kidneys, cleft palate, respiratory distress, and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T C 5: 146,502,852 I81T probably benign Het
5430419D17Rik T A 7: 131,243,142 V588E probably damaging Het
Acnat2 G A 4: 49,383,299 P85S probably damaging Het
Akr1c19 G A 13: 4,236,224 V74M probably damaging Het
Alb C A 5: 90,472,648 T539K probably benign Het
B4galnt2 G A 11: 95,869,397 T268I possibly damaging Het
Bcl7b G A 5: 135,177,132 E58K possibly damaging Het
Calr3 C T 8: 72,424,643 S372N unknown Het
Cdh20 A T 1: 104,947,322 probably null Het
Cdh7 A C 1: 110,048,947 E114A probably benign Het
Cep70 A G 9: 99,262,633 R74G possibly damaging Het
Chrna6 A G 8: 27,407,081 F256S probably damaging Het
Cic A G 7: 25,285,126 T996A probably benign Het
Clstn2 A G 9: 97,469,764 V536A possibly damaging Het
Csmd1 A T 8: 16,391,806 M348K probably benign Het
Dnah11 A C 12: 118,041,009 D2192E probably damaging Het
Dnhd1 A G 7: 105,703,439 I2600V probably benign Het
Dock3 A C 9: 106,908,501 S185A probably benign Het
Dock4 A T 12: 40,730,084 D628V possibly damaging Het
Dzank1 A T 2: 144,491,798 S371T probably benign Het
Fam83b A T 9: 76,492,455 N455K possibly damaging Het
Fcrlb T C 1: 170,908,796 Y137C probably damaging Het
Gtf2i G A 5: 134,266,617 T327M possibly damaging Het
Htt C T 5: 34,823,908 A875V probably benign Het
Hvcn1 G A 5: 122,238,638 probably null Het
Igsf10 A G 3: 59,330,724 S679P probably damaging Het
Itsn2 A G 12: 4,701,265 H1285R probably benign Het
Kcnq4 T C 4: 120,702,435 T523A probably benign Het
Kif6 T A 17: 49,832,186 I562N probably benign Het
Klhl9 C A 4: 88,720,338 W555C probably damaging Het
Krt78 T C 15: 101,948,189 T423A probably benign Het
Mapk10 C T 5: 102,963,496 V391I probably benign Het
Noa1 T C 5: 77,297,197 M592V probably benign Het
Npy5r A G 8: 66,681,316 M275T possibly damaging Het
Nuak2 T A 1: 132,331,957 V499E probably benign Het
Olfr1269 A T 2: 90,118,841 C252* probably null Het
Olfr806 T C 10: 129,738,690 I76V probably benign Het
Otogl T C 10: 107,777,109 E2052G probably benign Het
Pard3b T A 1: 62,159,511 C253S possibly damaging Het
Pclo T C 5: 14,677,214 S2029P unknown Het
Plekhg3 A G 12: 76,565,569 I401M probably damaging Het
Polg A T 7: 79,450,644 C1140S probably benign Het
Prl7c1 A T 13: 27,778,834 L62H probably damaging Het
Psmf1 T A 2: 151,734,243 E115V probably benign Het
Ptpn9 A T 9: 57,056,726 N381I possibly damaging Het
Pzp A G 6: 128,489,016 S1234P probably benign Het
Qrich1 A G 9: 108,559,286 T728A possibly damaging Het
Ralgps2 C A 1: 156,829,066 A323S probably benign Het
Rimbp3 T C 16: 17,211,046 V778A possibly damaging Het
Scn1a A T 2: 66,286,005 L430* probably null Het
Sema7a A T 9: 57,955,080 I189F probably damaging Het
Slc22a8 T C 19: 8,594,022 I39T probably benign Het
Stap2 T C 17: 56,002,023 T115A probably benign Het
Stmn4 A G 14: 66,357,939 I138V probably benign Het
Suds3 C T 5: 117,098,270 probably null Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tet1 A C 10: 62,879,046 D323E probably benign Het
Tia1 A G 6: 86,424,365 D140G probably damaging Het
Trio C T 15: 27,851,924 R827H possibly damaging Het
Ttn A G 2: 76,795,053 probably null Het
Unc80 T C 1: 66,510,707 V708A probably benign Het
Vmn1r194 A T 13: 22,244,602 T130S probably benign Het
Wfikkn2 A G 11: 94,238,929 C129R probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Hspa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:Hspa5 APN 2 34774718 missense probably benign
IGL01997:Hspa5 APN 2 34772315 utr 5 prime probably benign
IGL02239:Hspa5 APN 2 34772776 missense probably benign 0.00
IGL03326:Hspa5 APN 2 34776117 unclassified probably benign
R0281:Hspa5 UTSW 2 34774320 missense probably damaging 1.00
R1052:Hspa5 UTSW 2 34775098 missense probably damaging 0.99
R1687:Hspa5 UTSW 2 34775824 missense probably benign 0.00
R1741:Hspa5 UTSW 2 34772692 missense possibly damaging 0.91
R1833:Hspa5 UTSW 2 34776053 nonsense probably null
R1842:Hspa5 UTSW 2 34775803 missense probably damaging 1.00
R1851:Hspa5 UTSW 2 34774678 missense possibly damaging 0.64
R1864:Hspa5 UTSW 2 34774541 missense probably damaging 0.99
R1865:Hspa5 UTSW 2 34774541 missense probably damaging 0.99
R2173:Hspa5 UTSW 2 34774662 missense probably damaging 1.00
R5027:Hspa5 UTSW 2 34775815 missense probably damaging 1.00
R5889:Hspa5 UTSW 2 34774617 missense probably damaging 1.00
R6046:Hspa5 UTSW 2 34775749 missense possibly damaging 0.94
R6515:Hspa5 UTSW 2 34772404 missense probably benign 0.05
R7045:Hspa5 UTSW 2 34773192 missense probably damaging 0.99
R7046:Hspa5 UTSW 2 34773192 missense probably damaging 0.99
R7047:Hspa5 UTSW 2 34773192 missense probably damaging 0.99
R7049:Hspa5 UTSW 2 34773192 missense probably damaging 0.99
R7185:Hspa5 UTSW 2 34775126 missense probably damaging 1.00
R7238:Hspa5 UTSW 2 34772371 missense unknown
X0067:Hspa5 UTSW 2 34775101 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCGAGTGACAGCTGAAGAC -3'
(R):5'- CTCTAGCAGATCAGTGCACC -3'

Sequencing Primer
(F):5'- GCCTGACACCTGAAGAAATTG -3'
(R):5'- TCTAGCAGATCAGTGCACCTACAAC -3'
Posted On2019-12-20