Incidental Mutation 'R7879:Olfr1269'
ID608616
Institutional Source Beutler Lab
Gene Symbol Olfr1269
Ensembl Gene ENSMUSG00000084336
Gene Nameolfactory receptor 1269
SynonymsGA_x6K02T2Q125-51551618-51550689, MOR228-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R7879 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location90116187-90121412 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 90118841 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 252 (C252*)
Ref Sequence ENSEMBL: ENSMUSP00000150470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099756] [ENSMUST00000117787] [ENSMUST00000214404] [ENSMUST00000216493]
Predicted Effect probably null
Transcript: ENSMUST00000099756
AA Change: C252*
SMART Domains Protein: ENSMUSP00000097345
Gene: ENSMUSG00000084336
AA Change: C252*

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.8e-50 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.2e-5 PFAM
Pfam:7tm_1 39 285 5.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117787
Predicted Effect probably null
Transcript: ENSMUST00000214404
AA Change: C252*
Predicted Effect probably null
Transcript: ENSMUST00000216493
AA Change: C252*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T C 5: 146,502,852 I81T probably benign Het
5430419D17Rik T A 7: 131,243,142 V588E probably damaging Het
Acnat2 G A 4: 49,383,299 P85S probably damaging Het
Akr1c19 G A 13: 4,236,224 V74M probably damaging Het
Alb C A 5: 90,472,648 T539K probably benign Het
B4galnt2 G A 11: 95,869,397 T268I possibly damaging Het
Bcl7b G A 5: 135,177,132 E58K possibly damaging Het
Calr3 C T 8: 72,424,643 S372N unknown Het
Cdh20 A T 1: 104,947,322 probably null Het
Cdh7 A C 1: 110,048,947 E114A probably benign Het
Cep70 A G 9: 99,262,633 R74G possibly damaging Het
Chrna6 A G 8: 27,407,081 F256S probably damaging Het
Cic A G 7: 25,285,126 T996A probably benign Het
Clstn2 A G 9: 97,469,764 V536A possibly damaging Het
Csmd1 A T 8: 16,391,806 M348K probably benign Het
Dnah11 A C 12: 118,041,009 D2192E probably damaging Het
Dnhd1 A G 7: 105,703,439 I2600V probably benign Het
Dock3 A C 9: 106,908,501 S185A probably benign Het
Dock4 A T 12: 40,730,084 D628V possibly damaging Het
Dzank1 A T 2: 144,491,798 S371T probably benign Het
Fam83b A T 9: 76,492,455 N455K possibly damaging Het
Fcrlb T C 1: 170,908,796 Y137C probably damaging Het
Gtf2i G A 5: 134,266,617 T327M possibly damaging Het
Hspa5 T A 2: 34,775,929 M595K probably benign Het
Htt C T 5: 34,823,908 A875V probably benign Het
Hvcn1 G A 5: 122,238,638 probably null Het
Igsf10 A G 3: 59,330,724 S679P probably damaging Het
Itsn2 A G 12: 4,701,265 H1285R probably benign Het
Kcnq4 T C 4: 120,702,435 T523A probably benign Het
Kif6 T A 17: 49,832,186 I562N probably benign Het
Klhl9 C A 4: 88,720,338 W555C probably damaging Het
Krt78 T C 15: 101,948,189 T423A probably benign Het
Mapk10 C T 5: 102,963,496 V391I probably benign Het
Noa1 T C 5: 77,297,197 M592V probably benign Het
Npy5r A G 8: 66,681,316 M275T possibly damaging Het
Nuak2 T A 1: 132,331,957 V499E probably benign Het
Olfr806 T C 10: 129,738,690 I76V probably benign Het
Otogl T C 10: 107,777,109 E2052G probably benign Het
Pard3b T A 1: 62,159,511 C253S possibly damaging Het
Pclo T C 5: 14,677,214 S2029P unknown Het
Plekhg3 A G 12: 76,565,569 I401M probably damaging Het
Polg A T 7: 79,450,644 C1140S probably benign Het
Prl7c1 A T 13: 27,778,834 L62H probably damaging Het
Psmf1 T A 2: 151,734,243 E115V probably benign Het
Ptpn9 A T 9: 57,056,726 N381I possibly damaging Het
Pzp A G 6: 128,489,016 S1234P probably benign Het
Qrich1 A G 9: 108,559,286 T728A possibly damaging Het
Ralgps2 C A 1: 156,829,066 A323S probably benign Het
Rimbp3 T C 16: 17,211,046 V778A possibly damaging Het
Scn1a A T 2: 66,286,005 L430* probably null Het
Sema7a A T 9: 57,955,080 I189F probably damaging Het
Slc22a8 T C 19: 8,594,022 I39T probably benign Het
Stap2 T C 17: 56,002,023 T115A probably benign Het
Stmn4 A G 14: 66,357,939 I138V probably benign Het
Suds3 C T 5: 117,098,270 probably null Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tet1 A C 10: 62,879,046 D323E probably benign Het
Tia1 A G 6: 86,424,365 D140G probably damaging Het
Trio C T 15: 27,851,924 R827H possibly damaging Het
Ttn A G 2: 76,795,053 probably null Het
Unc80 T C 1: 66,510,707 V708A probably benign Het
Vmn1r194 A T 13: 22,244,602 T130S probably benign Het
Wfikkn2 A G 11: 94,238,929 C129R probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Olfr1269
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Olfr1269 APN 2 90119068 missense probably damaging 1.00
IGL01518:Olfr1269 APN 2 90118971 missense possibly damaging 0.95
IGL01889:Olfr1269 APN 2 90118965 missense possibly damaging 0.84
IGL02629:Olfr1269 APN 2 90118857 nonsense probably null
R0732:Olfr1269 UTSW 2 90119322 missense probably benign 0.20
R1446:Olfr1269 UTSW 2 90118858 missense probably damaging 0.98
R1938:Olfr1269 UTSW 2 90119083 missense probably damaging 0.97
R4526:Olfr1269 UTSW 2 90118672 missense probably benign 0.01
R4786:Olfr1269 UTSW 2 90119007 missense possibly damaging 0.95
R4792:Olfr1269 UTSW 2 90118830 missense possibly damaging 0.95
R4925:Olfr1269 UTSW 2 90118777 missense probably damaging 1.00
R5152:Olfr1269 UTSW 2 90119121 missense probably damaging 0.98
R5296:Olfr1269 UTSW 2 90118699 missense probably damaging 0.97
R5450:Olfr1269 UTSW 2 90118669 makesense probably null
R5536:Olfr1269 UTSW 2 90118839 missense probably benign 0.00
R7572:Olfr1269 UTSW 2 90118743 missense probably damaging 1.00
R7695:Olfr1269 UTSW 2 90118863 missense probably benign 0.08
R7938:Olfr1269 UTSW 2 90118829 nonsense probably null
R8280:Olfr1269 UTSW 2 90119398 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GTTTGGACTCAGCAGCATTCC -3'
(R):5'- GCTCAGACACCTTCCTCATTGG -3'

Sequencing Primer
(F):5'- GGACTCAGCAGCATTCCAATCC -3'
(R):5'- AGACACCTTCCTCATTGGTTTGC -3'
Posted On2019-12-20