Incidental Mutation 'R7879:Igsf10'
ID608620
Institutional Source Beutler Lab
Gene Symbol Igsf10
Ensembl Gene ENSMUSG00000036334
Gene Nameimmunoglobulin superfamily, member 10
SynonymsAdlican2, CMF608, 6530405F15Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001162884; MGI: 1923481

Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R7879 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location59316735-59344394 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59330724 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 679 (S679P)
Ref Sequence ENSEMBL: ENSMUSP00000037246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039419] [ENSMUST00000193455] [ENSMUST00000194546]
Predicted Effect probably damaging
Transcript: ENSMUST00000039419
AA Change: S679P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037246
Gene: ENSMUSG00000036334
AA Change: S679P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 28 61 3.24e-4 SMART
LRR 57 79 9.24e1 SMART
LRR 80 103 2.02e-1 SMART
LRR 104 127 7.16e0 SMART
LRR_TYP 128 151 1.2e-3 SMART
LRR 152 175 1.25e-1 SMART
LRR 188 207 2.33e2 SMART
LRRCT 219 280 4.19e-4 SMART
IGc2 488 558 2.34e-4 SMART
IGc2 586 652 7.88e-11 SMART
low complexity region 917 930 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
low complexity region 1245 1263 N/A INTRINSIC
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1449 1465 N/A INTRINSIC
IGc2 1632 1701 7.69e-14 SMART
IGc2 1729 1798 5.07e-14 SMART
IGc2 1826 1895 2.19e-9 SMART
IGc2 1925 1994 4.59e-12 SMART
IGc2 2022 2097 1.33e-8 SMART
IGc2 2125 2191 2.96e-15 SMART
IGc2 2223 2291 2.03e-4 SMART
IGc2 2321 2389 9.99e-13 SMART
IGc2 2416 2484 3.03e-12 SMART
IGc2 2512 2583 7.76e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000193455
AA Change: S679P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141971
Gene: ENSMUSG00000036334
AA Change: S679P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 28 61 3.24e-4 SMART
LRR 57 79 9.24e1 SMART
LRR 80 103 2.02e-1 SMART
LRR 104 127 7.16e0 SMART
LRR_TYP 128 151 1.2e-3 SMART
LRR 152 175 1.25e-1 SMART
LRR 188 207 2.33e2 SMART
LRRCT 219 280 4.19e-4 SMART
IGc2 488 558 2.34e-4 SMART
IGc2 586 652 7.88e-11 SMART
low complexity region 917 930 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
low complexity region 1245 1263 N/A INTRINSIC
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1449 1465 N/A INTRINSIC
IGc2 1632 1701 7.69e-14 SMART
IGc2 1729 1798 5.07e-14 SMART
IGc2 1826 1895 2.19e-9 SMART
IGc2 1925 1994 4.59e-12 SMART
IGc2 2022 2097 1.33e-8 SMART
IGc2 2125 2191 2.96e-15 SMART
IGc2 2223 2291 2.03e-4 SMART
IGc2 2321 2389 9.99e-13 SMART
IGc2 2416 2484 3.03e-12 SMART
IGc2 2512 2583 7.76e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000194546
AA Change: S679P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141391
Gene: ENSMUSG00000036334
AA Change: S679P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 28 61 3.24e-4 SMART
LRR 57 79 9.24e1 SMART
LRR 80 103 2.02e-1 SMART
LRR 104 127 7.16e0 SMART
LRR_TYP 128 151 1.2e-3 SMART
LRR 152 175 1.25e-1 SMART
LRR 188 207 2.33e2 SMART
LRRCT 219 280 4.19e-4 SMART
IGc2 488 558 2.34e-4 SMART
IGc2 586 652 7.88e-11 SMART
low complexity region 917 930 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
low complexity region 1245 1263 N/A INTRINSIC
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1449 1465 N/A INTRINSIC
IGc2 1632 1701 7.69e-14 SMART
IGc2 1729 1798 5.07e-14 SMART
IGc2 1826 1895 2.19e-9 SMART
IGc2 1925 1994 4.59e-12 SMART
IGc2 2022 2097 1.33e-8 SMART
IGc2 2125 2191 2.96e-15 SMART
IGc2 2223 2291 2.03e-4 SMART
IGc2 2321 2389 9.99e-13 SMART
IGc2 2416 2484 3.03e-12 SMART
IGc2 2512 2583 7.76e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T C 5: 146,502,852 I81T probably benign Het
5430419D17Rik T A 7: 131,243,142 V588E probably damaging Het
Acnat2 G A 4: 49,383,299 P85S probably damaging Het
Akr1c19 G A 13: 4,236,224 V74M probably damaging Het
Alb C A 5: 90,472,648 T539K probably benign Het
B4galnt2 G A 11: 95,869,397 T268I possibly damaging Het
Bcl7b G A 5: 135,177,132 E58K possibly damaging Het
Calr3 C T 8: 72,424,643 S372N unknown Het
Cdh20 A T 1: 104,947,322 probably null Het
Cdh7 A C 1: 110,048,947 E114A probably benign Het
Cep70 A G 9: 99,262,633 R74G possibly damaging Het
Chrna6 A G 8: 27,407,081 F256S probably damaging Het
Cic A G 7: 25,285,126 T996A probably benign Het
Clstn2 A G 9: 97,469,764 V536A possibly damaging Het
Csmd1 A T 8: 16,391,806 M348K probably benign Het
Dnah11 A C 12: 118,041,009 D2192E probably damaging Het
Dnhd1 A G 7: 105,703,439 I2600V probably benign Het
Dock3 A C 9: 106,908,501 S185A probably benign Het
Dock4 A T 12: 40,730,084 D628V possibly damaging Het
Dzank1 A T 2: 144,491,798 S371T probably benign Het
Fam83b A T 9: 76,492,455 N455K possibly damaging Het
Fcrlb T C 1: 170,908,796 Y137C probably damaging Het
Gtf2i G A 5: 134,266,617 T327M possibly damaging Het
Hspa5 T A 2: 34,775,929 M595K probably benign Het
Htt C T 5: 34,823,908 A875V probably benign Het
Hvcn1 G A 5: 122,238,638 probably null Het
Itsn2 A G 12: 4,701,265 H1285R probably benign Het
Kcnq4 T C 4: 120,702,435 T523A probably benign Het
Kif6 T A 17: 49,832,186 I562N probably benign Het
Klhl9 C A 4: 88,720,338 W555C probably damaging Het
Krt78 T C 15: 101,948,189 T423A probably benign Het
Mapk10 C T 5: 102,963,496 V391I probably benign Het
Noa1 T C 5: 77,297,197 M592V probably benign Het
Npy5r A G 8: 66,681,316 M275T possibly damaging Het
Nuak2 T A 1: 132,331,957 V499E probably benign Het
Olfr1269 A T 2: 90,118,841 C252* probably null Het
Olfr806 T C 10: 129,738,690 I76V probably benign Het
Otogl T C 10: 107,777,109 E2052G probably benign Het
Pard3b T A 1: 62,159,511 C253S possibly damaging Het
Pclo T C 5: 14,677,214 S2029P unknown Het
Plekhg3 A G 12: 76,565,569 I401M probably damaging Het
Polg A T 7: 79,450,644 C1140S probably benign Het
Prl7c1 A T 13: 27,778,834 L62H probably damaging Het
Psmf1 T A 2: 151,734,243 E115V probably benign Het
Ptpn9 A T 9: 57,056,726 N381I possibly damaging Het
Pzp A G 6: 128,489,016 S1234P probably benign Het
Qrich1 A G 9: 108,559,286 T728A possibly damaging Het
Ralgps2 C A 1: 156,829,066 A323S probably benign Het
Rimbp3 T C 16: 17,211,046 V778A possibly damaging Het
Scn1a A T 2: 66,286,005 L430* probably null Het
Sema7a A T 9: 57,955,080 I189F probably damaging Het
Slc22a8 T C 19: 8,594,022 I39T probably benign Het
Stap2 T C 17: 56,002,023 T115A probably benign Het
Stmn4 A G 14: 66,357,939 I138V probably benign Het
Suds3 C T 5: 117,098,270 probably null Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tet1 A C 10: 62,879,046 D323E probably benign Het
Tia1 A G 6: 86,424,365 D140G probably damaging Het
Trio C T 15: 27,851,924 R827H possibly damaging Het
Ttn A G 2: 76,795,053 probably null Het
Unc80 T C 1: 66,510,707 V708A probably benign Het
Vmn1r194 A T 13: 22,244,602 T130S probably benign Het
Wfikkn2 A G 11: 94,238,929 C129R probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Igsf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Igsf10 APN 3 59331539 missense probably benign 0.03
IGL00790:Igsf10 APN 3 59319517 missense probably damaging 1.00
IGL00916:Igsf10 APN 3 59331127 missense probably damaging 0.97
IGL00928:Igsf10 APN 3 59330597 missense probably benign 0.00
IGL01066:Igsf10 APN 3 59327782 critical splice donor site probably null
IGL01107:Igsf10 APN 3 59331524 missense probably damaging 1.00
IGL01420:Igsf10 APN 3 59319650 missense probably benign 0.02
IGL01533:Igsf10 APN 3 59319230 missense probably damaging 0.98
IGL01537:Igsf10 APN 3 59330031 missense probably benign 0.00
IGL01676:Igsf10 APN 3 59326011 missense probably benign 0.06
IGL01676:Igsf10 APN 3 59329335 missense probably benign 0.17
IGL01960:Igsf10 APN 3 59318737 missense probably benign 0.00
IGL02123:Igsf10 APN 3 59318660 missense probably damaging 0.97
IGL02198:Igsf10 APN 3 59325978 missense possibly damaging 0.95
IGL02268:Igsf10 APN 3 59331152 nonsense probably null
IGL02313:Igsf10 APN 3 59330690 missense probably benign 0.01
IGL02368:Igsf10 APN 3 59328231 missense probably benign
IGL02494:Igsf10 APN 3 59328006 missense probably damaging 0.98
IGL02549:Igsf10 APN 3 59329241 missense probably benign 0.03
IGL02616:Igsf10 APN 3 59318606 missense probably benign 0.06
IGL02957:Igsf10 APN 3 59330864 missense probably damaging 1.00
IGL03067:Igsf10 APN 3 59318918 missense probably benign 0.25
IGL03104:Igsf10 APN 3 59319484 missense probably damaging 1.00
IGL03124:Igsf10 APN 3 59319665 missense probably benign 0.01
IGL03212:Igsf10 APN 3 59328165 missense probably benign 0.09
IGL03347:Igsf10 APN 3 59331900 missense possibly damaging 0.94
IGL03357:Igsf10 APN 3 59336211 missense probably benign 0.35
F6893:Igsf10 UTSW 3 59331060 missense probably damaging 1.00
FR4449:Igsf10 UTSW 3 59319110 missense probably damaging 1.00
PIT1430001:Igsf10 UTSW 3 59328158 missense probably benign 0.06
PIT4402001:Igsf10 UTSW 3 59325579 missense probably benign 0.00
PIT4810001:Igsf10 UTSW 3 59318482 missense probably damaging 1.00
R0068:Igsf10 UTSW 3 59330624 missense probably damaging 0.98
R0095:Igsf10 UTSW 3 59331196 nonsense probably null
R0095:Igsf10 UTSW 3 59331196 nonsense probably null
R0112:Igsf10 UTSW 3 59326008 missense probably benign 0.00
R0141:Igsf10 UTSW 3 59330832 missense probably damaging 1.00
R0538:Igsf10 UTSW 3 59320106 missense probably damaging 0.99
R0551:Igsf10 UTSW 3 59328668 missense probably benign 0.01
R0556:Igsf10 UTSW 3 59328875 missense probably benign 0.02
R0582:Igsf10 UTSW 3 59319767 missense probably benign 0.00
R0630:Igsf10 UTSW 3 59326062 missense probably damaging 1.00
R0675:Igsf10 UTSW 3 59328594 missense probably benign 0.14
R0948:Igsf10 UTSW 3 59331104 missense probably damaging 1.00
R1252:Igsf10 UTSW 3 59331848 missense probably benign 0.03
R1412:Igsf10 UTSW 3 59327775 splice site probably benign
R1473:Igsf10 UTSW 3 59318767 missense probably damaging 1.00
R1585:Igsf10 UTSW 3 59330417 missense probably damaging 1.00
R1650:Igsf10 UTSW 3 59326162 missense probably damaging 1.00
R1660:Igsf10 UTSW 3 59331285 missense probably damaging 1.00
R1671:Igsf10 UTSW 3 59328500 nonsense probably null
R1748:Igsf10 UTSW 3 59319093 missense probably damaging 1.00
R1758:Igsf10 UTSW 3 59329196 missense probably benign 0.09
R1856:Igsf10 UTSW 3 59331272 missense possibly damaging 0.63
R1912:Igsf10 UTSW 3 59329572 missense probably benign 0.40
R2148:Igsf10 UTSW 3 59336577 missense possibly damaging 0.77
R2155:Igsf10 UTSW 3 59331680 missense probably damaging 1.00
R2509:Igsf10 UTSW 3 59331866 missense probably damaging 1.00
R2511:Igsf10 UTSW 3 59331866 missense probably damaging 1.00
R2680:Igsf10 UTSW 3 59325454 missense probably benign 0.14
R2913:Igsf10 UTSW 3 59331736 missense possibly damaging 0.70
R2927:Igsf10 UTSW 3 59329427 missense probably benign
R3547:Igsf10 UTSW 3 59330541 missense probably benign 0.02
R3547:Igsf10 UTSW 3 59336514 missense probably damaging 1.00
R3548:Igsf10 UTSW 3 59336514 missense probably damaging 1.00
R3620:Igsf10 UTSW 3 59336331 missense probably damaging 1.00
R3732:Igsf10 UTSW 3 59325714 missense probably benign 0.29
R3743:Igsf10 UTSW 3 59326125 missense possibly damaging 0.69
R3973:Igsf10 UTSW 3 59331924 missense probably damaging 1.00
R4005:Igsf10 UTSW 3 59328560 missense probably benign 0.00
R4184:Igsf10 UTSW 3 59319731 missense probably damaging 1.00
R4302:Igsf10 UTSW 3 59318750 missense probably damaging 1.00
R4404:Igsf10 UTSW 3 59329551 missense probably benign 0.04
R4575:Igsf10 UTSW 3 59330100 missense probably benign
R4676:Igsf10 UTSW 3 59325949 missense probably benign 0.23
R4700:Igsf10 UTSW 3 59320330 missense probably damaging 0.99
R4765:Igsf10 UTSW 3 59329705 missense probably benign 0.01
R4986:Igsf10 UTSW 3 59328606 missense probably benign 0.24
R5012:Igsf10 UTSW 3 59318722 missense probably damaging 1.00
R5070:Igsf10 UTSW 3 59328293 missense probably benign 0.02
R5083:Igsf10 UTSW 3 59326273 missense probably damaging 1.00
R5336:Igsf10 UTSW 3 59320132 missense probably damaging 1.00
R5462:Igsf10 UTSW 3 59325754 missense probably damaging 1.00
R5648:Igsf10 UTSW 3 59328153 missense probably benign 0.01
R5810:Igsf10 UTSW 3 59319071 missense probably damaging 1.00
R5871:Igsf10 UTSW 3 59330411 missense possibly damaging 0.83
R5880:Igsf10 UTSW 3 59330831 missense probably damaging 1.00
R5935:Igsf10 UTSW 3 59328157 missense probably benign 0.12
R5979:Igsf10 UTSW 3 59336473 missense probably damaging 1.00
R6145:Igsf10 UTSW 3 59331656 missense possibly damaging 0.83
R6222:Igsf10 UTSW 3 59318915 missense possibly damaging 0.90
R6224:Igsf10 UTSW 3 59325510 missense probably damaging 1.00
R6264:Igsf10 UTSW 3 59328507 missense possibly damaging 0.88
R6283:Igsf10 UTSW 3 59319449 missense probably damaging 1.00
R6336:Igsf10 UTSW 3 59330339 missense probably benign 0.00
R6490:Igsf10 UTSW 3 59329571 missense probably benign 0.06
R6785:Igsf10 UTSW 3 59319244 missense probably damaging 1.00
R6873:Igsf10 UTSW 3 59328444 missense probably benign
R6889:Igsf10 UTSW 3 59331933 missense probably benign
R7024:Igsf10 UTSW 3 59331701 missense probably benign 0.00
R7056:Igsf10 UTSW 3 59331080 missense probably damaging 1.00
R7128:Igsf10 UTSW 3 59328905 missense probably benign
R7251:Igsf10 UTSW 3 59319454 missense probably damaging 1.00
R7313:Igsf10 UTSW 3 59329416 missense probably benign 0.05
R7340:Igsf10 UTSW 3 59325768 missense probably damaging 1.00
R7447:Igsf10 UTSW 3 59331801 missense probably benign 0.39
R7506:Igsf10 UTSW 3 59319354 missense probably damaging 1.00
R7678:Igsf10 UTSW 3 59319340 missense possibly damaging 0.81
R7695:Igsf10 UTSW 3 59326191 missense probably damaging 1.00
R7709:Igsf10 UTSW 3 59331543 missense probably damaging 0.96
R7749:Igsf10 UTSW 3 59329128 missense possibly damaging 0.88
R7808:Igsf10 UTSW 3 59328068 missense probably benign 0.00
R7850:Igsf10 UTSW 3 59319632 missense probably benign 0.33
R7886:Igsf10 UTSW 3 59328327 missense probably benign 0.01
R7891:Igsf10 UTSW 3 59328411 nonsense probably null
R7946:Igsf10 UTSW 3 59319704 missense possibly damaging 0.69
R7948:Igsf10 UTSW 3 59331858 missense probably benign 0.02
R8004:Igsf10 UTSW 3 59329709 missense probably benign 0.01
R8096:Igsf10 UTSW 3 59328959 missense probably damaging 0.98
R8141:Igsf10 UTSW 3 59330528 missense probably damaging 0.96
R8183:Igsf10 UTSW 3 59330615 missense probably benign 0.04
R8203:Igsf10 UTSW 3 59328833 missense probably benign 0.11
R8325:Igsf10 UTSW 3 59318533 missense probably damaging 0.96
R8387:Igsf10 UTSW 3 59329143 missense probably damaging 1.00
Z1088:Igsf10 UTSW 3 59329938 missense possibly damaging 0.59
Z1177:Igsf10 UTSW 3 59329605 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGAATCTCCGGAGAGTGGAATC -3'
(R):5'- TTAGCTGGATTCTTCCCCGG -3'

Sequencing Primer
(F):5'- AATCCCCACGCCGTCGATG -3'
(R):5'- GTTCTCTCAGTCATCAAGAGACATGC -3'
Posted On2019-12-20