Incidental Mutation 'R7879:Klhl9'
ID608622
Institutional Source Beutler Lab
Gene Symbol Klhl9
Ensembl Gene ENSMUSG00000070923
Gene Namekelch-like 9
SynonymsC530050O22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7879 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location88718292-88722465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 88720338 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Cysteine at position 555 (W555C)
Ref Sequence ENSEMBL: ENSMUSP00000092602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094993] [ENSMUST00000181601]
Predicted Effect probably damaging
Transcript: ENSMUST00000094993
AA Change: W555C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092602
Gene: ENSMUSG00000070923
AA Change: W555C

DomainStartEndE-ValueType
BTB 50 149 7.21e-22 SMART
BACK 154 255 3.93e-27 SMART
low complexity region 276 287 N/A INTRINSIC
Kelch 299 347 1.13e-2 SMART
Kelch 348 399 1.92e-5 SMART
Kelch 400 446 1.59e-11 SMART
Kelch 447 493 2.61e-7 SMART
Kelch 494 545 1.58e-6 SMART
Kelch 546 594 1.43e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181601
SMART Domains Protein: ENSMUSP00000137773
Gene: ENSMUSG00000097078

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the kelch repeat-containing family, and contains an N-terminal BTB/POZ domain, a BACK domain and six C-terminal kelch repeats. The encoded protein is a component of a complex with cullin 3-based E3 ligase, which plays a role in mitosis. This protein complex is a cell cycle regulator, and functions in the organization and integrity of the spindle midzone in anaphase and the completion of cytokinesis. The complex is required for the removal of the chromosomal passenger protein aurora B from mitotic chromosomes. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T C 5: 146,502,852 I81T probably benign Het
5430419D17Rik T A 7: 131,243,142 V588E probably damaging Het
Acnat2 G A 4: 49,383,299 P85S probably damaging Het
Akr1c19 G A 13: 4,236,224 V74M probably damaging Het
Alb C A 5: 90,472,648 T539K probably benign Het
B4galnt2 G A 11: 95,869,397 T268I possibly damaging Het
Bcl7b G A 5: 135,177,132 E58K possibly damaging Het
Calr3 C T 8: 72,424,643 S372N unknown Het
Cdh20 A T 1: 104,947,322 probably null Het
Cdh7 A C 1: 110,048,947 E114A probably benign Het
Cep70 A G 9: 99,262,633 R74G possibly damaging Het
Chrna6 A G 8: 27,407,081 F256S probably damaging Het
Cic A G 7: 25,285,126 T996A probably benign Het
Clstn2 A G 9: 97,469,764 V536A possibly damaging Het
Csmd1 A T 8: 16,391,806 M348K probably benign Het
Dnah11 A C 12: 118,041,009 D2192E probably damaging Het
Dnhd1 A G 7: 105,703,439 I2600V probably benign Het
Dock3 A C 9: 106,908,501 S185A probably benign Het
Dock4 A T 12: 40,730,084 D628V possibly damaging Het
Dzank1 A T 2: 144,491,798 S371T probably benign Het
Fam83b A T 9: 76,492,455 N455K possibly damaging Het
Fcrlb T C 1: 170,908,796 Y137C probably damaging Het
Gtf2i G A 5: 134,266,617 T327M possibly damaging Het
Hspa5 T A 2: 34,775,929 M595K probably benign Het
Htt C T 5: 34,823,908 A875V probably benign Het
Hvcn1 G A 5: 122,238,638 probably null Het
Igsf10 A G 3: 59,330,724 S679P probably damaging Het
Itsn2 A G 12: 4,701,265 H1285R probably benign Het
Kcnq4 T C 4: 120,702,435 T523A probably benign Het
Kif6 T A 17: 49,832,186 I562N probably benign Het
Krt78 T C 15: 101,948,189 T423A probably benign Het
Mapk10 C T 5: 102,963,496 V391I probably benign Het
Noa1 T C 5: 77,297,197 M592V probably benign Het
Npy5r A G 8: 66,681,316 M275T possibly damaging Het
Nuak2 T A 1: 132,331,957 V499E probably benign Het
Olfr1269 A T 2: 90,118,841 C252* probably null Het
Olfr806 T C 10: 129,738,690 I76V probably benign Het
Otogl T C 10: 107,777,109 E2052G probably benign Het
Pard3b T A 1: 62,159,511 C253S possibly damaging Het
Pclo T C 5: 14,677,214 S2029P unknown Het
Plekhg3 A G 12: 76,565,569 I401M probably damaging Het
Polg A T 7: 79,450,644 C1140S probably benign Het
Prl7c1 A T 13: 27,778,834 L62H probably damaging Het
Psmf1 T A 2: 151,734,243 E115V probably benign Het
Ptpn9 A T 9: 57,056,726 N381I possibly damaging Het
Pzp A G 6: 128,489,016 S1234P probably benign Het
Qrich1 A G 9: 108,559,286 T728A possibly damaging Het
Ralgps2 C A 1: 156,829,066 A323S probably benign Het
Rimbp3 T C 16: 17,211,046 V778A possibly damaging Het
Scn1a A T 2: 66,286,005 L430* probably null Het
Sema7a A T 9: 57,955,080 I189F probably damaging Het
Slc22a8 T C 19: 8,594,022 I39T probably benign Het
Stap2 T C 17: 56,002,023 T115A probably benign Het
Stmn4 A G 14: 66,357,939 I138V probably benign Het
Suds3 C T 5: 117,098,270 probably null Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tet1 A C 10: 62,879,046 D323E probably benign Het
Tia1 A G 6: 86,424,365 D140G probably damaging Het
Trio C T 15: 27,851,924 R827H possibly damaging Het
Ttn A G 2: 76,795,053 probably null Het
Unc80 T C 1: 66,510,707 V708A probably benign Het
Vmn1r194 A T 13: 22,244,602 T130S probably benign Het
Wfikkn2 A G 11: 94,238,929 C129R probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Klhl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Klhl9 APN 4 88720819 missense probably damaging 1.00
IGL00592:Klhl9 APN 4 88721141 missense probably damaging 0.99
IGL01986:Klhl9 APN 4 88721779 missense probably damaging 0.99
IGL02364:Klhl9 APN 4 88721170 missense probably damaging 1.00
IGL02994:Klhl9 APN 4 88721197 nonsense probably null
minnow UTSW 4 88721606 nonsense probably null
R0319:Klhl9 UTSW 4 88720454 missense possibly damaging 0.91
R0360:Klhl9 UTSW 4 88720290 missense probably benign 0.05
R0364:Klhl9 UTSW 4 88720290 missense probably benign 0.05
R0693:Klhl9 UTSW 4 88720290 missense probably benign 0.05
R0961:Klhl9 UTSW 4 88721737 missense probably benign 0.16
R1521:Klhl9 UTSW 4 88721993 missense probably benign 0.03
R2891:Klhl9 UTSW 4 88720970 missense probably benign 0.02
R3762:Klhl9 UTSW 4 88721593 missense possibly damaging 0.93
R4584:Klhl9 UTSW 4 88721907 missense probably damaging 1.00
R4678:Klhl9 UTSW 4 88720924 missense probably damaging 1.00
R4888:Klhl9 UTSW 4 88721945 missense probably benign 0.01
R5030:Klhl9 UTSW 4 88720534 missense possibly damaging 0.96
R5082:Klhl9 UTSW 4 88721385 missense probably damaging 0.97
R6466:Klhl9 UTSW 4 88721162 missense probably benign 0.00
R7032:Klhl9 UTSW 4 88721606 nonsense probably null
R7532:Klhl9 UTSW 4 88720853 missense possibly damaging 0.79
R7602:Klhl9 UTSW 4 88722409 start gained probably benign
R7618:Klhl9 UTSW 4 88720535 missense possibly damaging 0.80
R7909:Klhl9 UTSW 4 88721001 missense probably benign 0.12
R8372:Klhl9 UTSW 4 88721359 missense probably damaging 1.00
X0063:Klhl9 UTSW 4 88721951 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGGTGCTGAAAGAGGTGATTCTC -3'
(R):5'- ACAGTCCGAGGTCTGCATTG -3'

Sequencing Primer
(F):5'- TGATTCTCTAGAAGGTGACCCAG -3'
(R):5'- CTGTATGTCATCGGTGGCAACC -3'
Posted On2019-12-20