Incidental Mutation 'R7879:Kcnq4'
ID608623
Institutional Source Beutler Lab
Gene Symbol Kcnq4
Ensembl Gene ENSMUSG00000028631
Gene Namepotassium voltage-gated channel, subfamily Q, member 4
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.456) question?
Stock #R7879 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location120696138-120748612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120702435 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 523 (T523A)
Ref Sequence ENSEMBL: ENSMUSP00000030376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030376]
Predicted Effect probably benign
Transcript: ENSMUST00000030376
AA Change: T523A

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000030376
Gene: ENSMUSG00000028631
AA Change: T523A

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 36 77 N/A INTRINSIC
Pfam:Ion_trans 99 331 1.2e-28 PFAM
Pfam:Ion_trans_2 244 324 5.4e-16 PFAM
Pfam:KCNQ_channel 465 655 1.6e-93 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a potassium channel that is thought to play a critical role in the regulation of neuronal excitability, particularly in sensory cells of the cochlea. The current generated by this channel is inhibited by M1 muscarinic acetylcholine receptors and activated by retigabine, a novel anti-convulsant drug. The encoded protein can form a homomultimeric potassium channel or possibly a heteromultimeric channel in association with the protein encoded by the KCNQ3 gene. Defects in this gene are a cause of nonsyndromic sensorineural deafness type 2 (DFNA2), an autosomal dominant form of progressive hearing loss. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either homozygous for a knock-out allele or homozygous for a dominant negative knock-in allele exhibit a slowly progressive hearing loss due to chronic depolarization and subsequent degeneration of cochlear outer hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T C 5: 146,502,852 I81T probably benign Het
5430419D17Rik T A 7: 131,243,142 V588E probably damaging Het
Acnat2 G A 4: 49,383,299 P85S probably damaging Het
Akr1c19 G A 13: 4,236,224 V74M probably damaging Het
Alb C A 5: 90,472,648 T539K probably benign Het
B4galnt2 G A 11: 95,869,397 T268I possibly damaging Het
Bcl7b G A 5: 135,177,132 E58K possibly damaging Het
Calr3 C T 8: 72,424,643 S372N unknown Het
Cdh20 A T 1: 104,947,322 probably null Het
Cdh7 A C 1: 110,048,947 E114A probably benign Het
Cep70 A G 9: 99,262,633 R74G possibly damaging Het
Chrna6 A G 8: 27,407,081 F256S probably damaging Het
Cic A G 7: 25,285,126 T996A probably benign Het
Clstn2 A G 9: 97,469,764 V536A possibly damaging Het
Csmd1 A T 8: 16,391,806 M348K probably benign Het
Dnah11 A C 12: 118,041,009 D2192E probably damaging Het
Dnhd1 A G 7: 105,703,439 I2600V probably benign Het
Dock3 A C 9: 106,908,501 S185A probably benign Het
Dock4 A T 12: 40,730,084 D628V possibly damaging Het
Dzank1 A T 2: 144,491,798 S371T probably benign Het
Fam83b A T 9: 76,492,455 N455K possibly damaging Het
Fcrlb T C 1: 170,908,796 Y137C probably damaging Het
Gtf2i G A 5: 134,266,617 T327M possibly damaging Het
Hspa5 T A 2: 34,775,929 M595K probably benign Het
Htt C T 5: 34,823,908 A875V probably benign Het
Hvcn1 G A 5: 122,238,638 probably null Het
Igsf10 A G 3: 59,330,724 S679P probably damaging Het
Itsn2 A G 12: 4,701,265 H1285R probably benign Het
Kif6 T A 17: 49,832,186 I562N probably benign Het
Klhl9 C A 4: 88,720,338 W555C probably damaging Het
Krt78 T C 15: 101,948,189 T423A probably benign Het
Mapk10 C T 5: 102,963,496 V391I probably benign Het
Noa1 T C 5: 77,297,197 M592V probably benign Het
Npy5r A G 8: 66,681,316 M275T possibly damaging Het
Nuak2 T A 1: 132,331,957 V499E probably benign Het
Olfr1269 A T 2: 90,118,841 C252* probably null Het
Olfr806 T C 10: 129,738,690 I76V probably benign Het
Otogl T C 10: 107,777,109 E2052G probably benign Het
Pard3b T A 1: 62,159,511 C253S possibly damaging Het
Pclo T C 5: 14,677,214 S2029P unknown Het
Plekhg3 A G 12: 76,565,569 I401M probably damaging Het
Polg A T 7: 79,450,644 C1140S probably benign Het
Prl7c1 A T 13: 27,778,834 L62H probably damaging Het
Psmf1 T A 2: 151,734,243 E115V probably benign Het
Ptpn9 A T 9: 57,056,726 N381I possibly damaging Het
Pzp A G 6: 128,489,016 S1234P probably benign Het
Qrich1 A G 9: 108,559,286 T728A possibly damaging Het
Ralgps2 C A 1: 156,829,066 A323S probably benign Het
Rimbp3 T C 16: 17,211,046 V778A possibly damaging Het
Scn1a A T 2: 66,286,005 L430* probably null Het
Sema7a A T 9: 57,955,080 I189F probably damaging Het
Slc22a8 T C 19: 8,594,022 I39T probably benign Het
Stap2 T C 17: 56,002,023 T115A probably benign Het
Stmn4 A G 14: 66,357,939 I138V probably benign Het
Suds3 C T 5: 117,098,270 probably null Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tet1 A C 10: 62,879,046 D323E probably benign Het
Tia1 A G 6: 86,424,365 D140G probably damaging Het
Trio C T 15: 27,851,924 R827H possibly damaging Het
Ttn A G 2: 76,795,053 probably null Het
Unc80 T C 1: 66,510,707 V708A probably benign Het
Vmn1r194 A T 13: 22,244,602 T130S probably benign Het
Wfikkn2 A G 11: 94,238,929 C129R probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Kcnq4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Kcnq4 APN 4 120698016 nonsense probably null
IGL00225:Kcnq4 APN 4 120698016 nonsense probably null
IGL00228:Kcnq4 APN 4 120698016 nonsense probably null
IGL00310:Kcnq4 APN 4 120698016 nonsense probably null
IGL00330:Kcnq4 APN 4 120698016 nonsense probably null
IGL00333:Kcnq4 APN 4 120698016 nonsense probably null
IGL00335:Kcnq4 APN 4 120698016 nonsense probably null
IGL00336:Kcnq4 APN 4 120698016 nonsense probably null
IGL01143:Kcnq4 APN 4 120698623 missense probably damaging 1.00
IGL01373:Kcnq4 APN 4 120717032 missense probably damaging 1.00
IGL02095:Kcnq4 APN 4 120700027 splice site probably benign
IGL02335:Kcnq4 APN 4 120715854 missense probably damaging 1.00
IGL03188:Kcnq4 APN 4 120704426 missense possibly damaging 0.81
R0045:Kcnq4 UTSW 4 120697955 missense probably damaging 0.99
R0045:Kcnq4 UTSW 4 120697955 missense probably damaging 0.99
R0423:Kcnq4 UTSW 4 120717508 missense probably damaging 1.00
R0483:Kcnq4 UTSW 4 120716601 missense probably damaging 1.00
R0837:Kcnq4 UTSW 4 120746861 missense probably benign 0.00
R1722:Kcnq4 UTSW 4 120702427 missense probably benign 0.00
R1826:Kcnq4 UTSW 4 120704504 missense probably benign 0.00
R2059:Kcnq4 UTSW 4 120698002 missense probably benign 0.00
R4327:Kcnq4 UTSW 4 120711364 missense probably benign 0.00
R4690:Kcnq4 UTSW 4 120717011 missense probably damaging 0.99
R4706:Kcnq4 UTSW 4 120704486 missense probably benign
R4729:Kcnq4 UTSW 4 120713074 missense possibly damaging 0.47
R4806:Kcnq4 UTSW 4 120713094 missense probably damaging 1.00
R4859:Kcnq4 UTSW 4 120716613 missense probably damaging 1.00
R4885:Kcnq4 UTSW 4 120713063 missense probably benign 0.01
R5073:Kcnq4 UTSW 4 120717517 missense probably damaging 1.00
R5517:Kcnq4 UTSW 4 120715809 missense possibly damaging 0.66
R5590:Kcnq4 UTSW 4 120715885 missense probably damaging 0.98
R5653:Kcnq4 UTSW 4 120702411 missense probably benign 0.00
R5750:Kcnq4 UTSW 4 120715049 missense probably damaging 1.00
R6141:Kcnq4 UTSW 4 120715869 missense probably damaging 1.00
R6160:Kcnq4 UTSW 4 120716559 missense probably damaging 1.00
R7087:Kcnq4 UTSW 4 120704399 missense probably damaging 0.96
R7088:Kcnq4 UTSW 4 120704399 missense probably damaging 0.96
R7143:Kcnq4 UTSW 4 120711239 missense probably benign 0.05
R7225:Kcnq4 UTSW 4 120746914 missense probably benign 0.03
R7479:Kcnq4 UTSW 4 120715825 missense probably damaging 0.98
R7574:Kcnq4 UTSW 4 120711368 missense probably benign
R7980:Kcnq4 UTSW 4 120711297 missense probably benign 0.02
X0020:Kcnq4 UTSW 4 120715327 missense probably damaging 1.00
Z1176:Kcnq4 UTSW 4 120698497 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTGCTGGAAGCCATATGC -3'
(R):5'- TGTCACCAGGCAGATGTCTG -3'

Sequencing Primer
(F):5'- GCCATATGCTCCTGTCCACAG -3'
(R):5'- TACCCTTGAGCCGCAGAAG -3'
Posted On2019-12-20