Incidental Mutation 'R7879:Suds3'
ID608629
Institutional Source Beutler Lab
Gene Symbol Suds3
Ensembl Gene ENSMUSG00000066900
Gene Namesuppressor of defective silencing 3 homolog (S. cerevisiae)
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7879 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location117091680-117116113 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 117098270 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086471] [ENSMUST00000166397]
Predicted Effect probably null
Transcript: ENSMUST00000086471
SMART Domains Protein: ENSMUSP00000083662
Gene: ENSMUSG00000066900

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
Pfam:Sds3 52 223 3.6e-30 PFAM
low complexity region 225 238 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166397
SMART Domains Protein: ENSMUSP00000130535
Gene: ENSMUSG00000066900

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
low complexity region 44 56 N/A INTRINSIC
Pfam:Sds3 61 296 4.7e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SDS3 is a subunit of the histone deacetylase (see HDAC1; MIM 601241)-dependent SIN3A (MIM 607776) corepressor complex (Fleischer et al., 2003 [PubMed 12724404]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality in the peri-implantation period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T C 5: 146,502,852 I81T probably benign Het
5430419D17Rik T A 7: 131,243,142 V588E probably damaging Het
Acnat2 G A 4: 49,383,299 P85S probably damaging Het
Akr1c19 G A 13: 4,236,224 V74M probably damaging Het
Alb C A 5: 90,472,648 T539K probably benign Het
B4galnt2 G A 11: 95,869,397 T268I possibly damaging Het
Bcl7b G A 5: 135,177,132 E58K possibly damaging Het
Calr3 C T 8: 72,424,643 S372N unknown Het
Cdh20 A T 1: 104,947,322 probably null Het
Cdh7 A C 1: 110,048,947 E114A probably benign Het
Cep70 A G 9: 99,262,633 R74G possibly damaging Het
Chrna6 A G 8: 27,407,081 F256S probably damaging Het
Cic A G 7: 25,285,126 T996A probably benign Het
Clstn2 A G 9: 97,469,764 V536A possibly damaging Het
Csmd1 A T 8: 16,391,806 M348K probably benign Het
Dnah11 A C 12: 118,041,009 D2192E probably damaging Het
Dnhd1 A G 7: 105,703,439 I2600V probably benign Het
Dock3 A C 9: 106,908,501 S185A probably benign Het
Dock4 A T 12: 40,730,084 D628V possibly damaging Het
Dzank1 A T 2: 144,491,798 S371T probably benign Het
Fam83b A T 9: 76,492,455 N455K possibly damaging Het
Fcrlb T C 1: 170,908,796 Y137C probably damaging Het
Gtf2i G A 5: 134,266,617 T327M possibly damaging Het
Hspa5 T A 2: 34,775,929 M595K probably benign Het
Htt C T 5: 34,823,908 A875V probably benign Het
Hvcn1 G A 5: 122,238,638 probably null Het
Igsf10 A G 3: 59,330,724 S679P probably damaging Het
Itsn2 A G 12: 4,701,265 H1285R probably benign Het
Kcnq4 T C 4: 120,702,435 T523A probably benign Het
Kif6 T A 17: 49,832,186 I562N probably benign Het
Klhl9 C A 4: 88,720,338 W555C probably damaging Het
Krt78 T C 15: 101,948,189 T423A probably benign Het
Mapk10 C T 5: 102,963,496 V391I probably benign Het
Noa1 T C 5: 77,297,197 M592V probably benign Het
Npy5r A G 8: 66,681,316 M275T possibly damaging Het
Nuak2 T A 1: 132,331,957 V499E probably benign Het
Olfr1269 A T 2: 90,118,841 C252* probably null Het
Olfr806 T C 10: 129,738,690 I76V probably benign Het
Otogl T C 10: 107,777,109 E2052G probably benign Het
Pard3b T A 1: 62,159,511 C253S possibly damaging Het
Pclo T C 5: 14,677,214 S2029P unknown Het
Plekhg3 A G 12: 76,565,569 I401M probably damaging Het
Polg A T 7: 79,450,644 C1140S probably benign Het
Prl7c1 A T 13: 27,778,834 L62H probably damaging Het
Psmf1 T A 2: 151,734,243 E115V probably benign Het
Ptpn9 A T 9: 57,056,726 N381I possibly damaging Het
Pzp A G 6: 128,489,016 S1234P probably benign Het
Qrich1 A G 9: 108,559,286 T728A possibly damaging Het
Ralgps2 C A 1: 156,829,066 A323S probably benign Het
Rimbp3 T C 16: 17,211,046 V778A possibly damaging Het
Scn1a A T 2: 66,286,005 L430* probably null Het
Sema7a A T 9: 57,955,080 I189F probably damaging Het
Slc22a8 T C 19: 8,594,022 I39T probably benign Het
Stap2 T C 17: 56,002,023 T115A probably benign Het
Stmn4 A G 14: 66,357,939 I138V probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tet1 A C 10: 62,879,046 D323E probably benign Het
Tia1 A G 6: 86,424,365 D140G probably damaging Het
Trio C T 15: 27,851,924 R827H possibly damaging Het
Ttn A G 2: 76,795,053 probably null Het
Unc80 T C 1: 66,510,707 V708A probably benign Het
Vmn1r194 A T 13: 22,244,602 T130S probably benign Het
Wfikkn2 A G 11: 94,238,929 C129R probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Suds3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02675:Suds3 APN 5 117094905 splice site probably null
IGL02713:Suds3 APN 5 117094905 splice site probably null
R1779:Suds3 UTSW 5 117105244 missense probably benign 0.02
R1986:Suds3 UTSW 5 117108352 missense probably damaging 0.98
R2519:Suds3 UTSW 5 117094953 missense probably damaging 1.00
R5189:Suds3 UTSW 5 117100599 critical splice donor site probably benign
R6213:Suds3 UTSW 5 117106662 missense probably damaging 0.99
R7756:Suds3 UTSW 5 117115737 missense unknown
R7758:Suds3 UTSW 5 117115737 missense unknown
R7818:Suds3 UTSW 5 117115749 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGCTGCACTCAGTATTCAAGAC -3'
(R):5'- TACACCTCAAGGACTTGGCG -3'

Sequencing Primer
(F):5'- TGCACTCAGTATTCAAGACTCCGAG -3'
(R):5'- TGCATCAGTCCCTGCGTG -3'
Posted On2019-12-20