Incidental Mutation 'R7879:Hvcn1'
ID608630
Institutional Source Beutler Lab
Gene Symbol Hvcn1
Ensembl Gene ENSMUSG00000064267
Gene Namehydrogen voltage-gated channel 1
SynonymsBTS, 0610039P13Rik, mVSOP
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R7879 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location122206804-122242297 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 122238638 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000072401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072602] [ENSMUST00000100747] [ENSMUST00000111738] [ENSMUST00000141281] [ENSMUST00000143560] [ENSMUST00000196187]
PDB Structure
Crystal Structure of a parallel coiled-coil dimerization domain from the voltage-gated proton channel [X-RAY DIFFRACTION]
Crystal Structure of a parallel coiled-coil dimerization domain from the voltage-gated proton channel (REDUCTION/DTT) [X-RAY DIFFRACTION]
Crystal Structure of a parallel coiled-coil dimerization domain from the voltage-gated proton channel (oxidation/H2O2) [X-RAY DIFFRACTION]
Crystal Structure of a parallel coiled-coil dimerization domain from the voltage-gated proton channel (mutation/C245S) [X-RAY DIFFRACTION]
Crystal Structure of a trimeric coiled-coil (I/I-type) assembly domain from the voltage-gated proton channel mutant [X-RAY DIFFRACTION]
Voltage-gated proton channel: VSOP/Hv1 chimeric channel [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000072602
SMART Domains Protein: ENSMUSP00000072401
Gene: ENSMUSG00000064267

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
Pfam:Ion_trans 94 226 1.2e-9 PFAM
Pfam:VGPC1_C 222 269 1.5e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000100747
SMART Domains Protein: ENSMUSP00000098312
Gene: ENSMUSG00000064267

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
low complexity region 104 120 N/A INTRINSIC
Pfam:Ion_trans 137 226 2.9e-7 PFAM
low complexity region 255 266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111738
SMART Domains Protein: ENSMUSP00000107367
Gene: ENSMUSG00000038593

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 24 36 N/A INTRINSIC
Pfam:DUF1619 82 395 8.4e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141281
SMART Domains Protein: ENSMUSP00000114820
Gene: ENSMUSG00000038593

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 24 36 N/A INTRINSIC
Pfam:DUF1619 82 384 1.5e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143560
SMART Domains Protein: ENSMUSP00000118013
Gene: ENSMUSG00000064267

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
PDB:3WKV|A 73 157 9e-33 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000196187
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated protein channel protein expressed more highly in certain cells of the immune system. Phagocytic cells produce superoxide anions which require this channel protein, and in B cells this same process facilitates antibody production. This same channel protein, however, can also regulate functions in other cells including spermatozoa. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a gene trap allele lack neutrophil and macrophage voltage-gated proton pumps. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T C 5: 146,502,852 I81T probably benign Het
5430419D17Rik T A 7: 131,243,142 V588E probably damaging Het
Acnat2 G A 4: 49,383,299 P85S probably damaging Het
Akr1c19 G A 13: 4,236,224 V74M probably damaging Het
Alb C A 5: 90,472,648 T539K probably benign Het
B4galnt2 G A 11: 95,869,397 T268I possibly damaging Het
Bcl7b G A 5: 135,177,132 E58K possibly damaging Het
Calr3 C T 8: 72,424,643 S372N unknown Het
Cdh20 A T 1: 104,947,322 probably null Het
Cdh7 A C 1: 110,048,947 E114A probably benign Het
Cep70 A G 9: 99,262,633 R74G possibly damaging Het
Chrna6 A G 8: 27,407,081 F256S probably damaging Het
Cic A G 7: 25,285,126 T996A probably benign Het
Clstn2 A G 9: 97,469,764 V536A possibly damaging Het
Csmd1 A T 8: 16,391,806 M348K probably benign Het
Dnah11 A C 12: 118,041,009 D2192E probably damaging Het
Dnhd1 A G 7: 105,703,439 I2600V probably benign Het
Dock3 A C 9: 106,908,501 S185A probably benign Het
Dock4 A T 12: 40,730,084 D628V possibly damaging Het
Dzank1 A T 2: 144,491,798 S371T probably benign Het
Fam83b A T 9: 76,492,455 N455K possibly damaging Het
Fcrlb T C 1: 170,908,796 Y137C probably damaging Het
Gtf2i G A 5: 134,266,617 T327M possibly damaging Het
Hspa5 T A 2: 34,775,929 M595K probably benign Het
Htt C T 5: 34,823,908 A875V probably benign Het
Igsf10 A G 3: 59,330,724 S679P probably damaging Het
Itsn2 A G 12: 4,701,265 H1285R probably benign Het
Kcnq4 T C 4: 120,702,435 T523A probably benign Het
Kif6 T A 17: 49,832,186 I562N probably benign Het
Klhl9 C A 4: 88,720,338 W555C probably damaging Het
Krt78 T C 15: 101,948,189 T423A probably benign Het
Mapk10 C T 5: 102,963,496 V391I probably benign Het
Noa1 T C 5: 77,297,197 M592V probably benign Het
Npy5r A G 8: 66,681,316 M275T possibly damaging Het
Nuak2 T A 1: 132,331,957 V499E probably benign Het
Olfr1269 A T 2: 90,118,841 C252* probably null Het
Olfr806 T C 10: 129,738,690 I76V probably benign Het
Otogl T C 10: 107,777,109 E2052G probably benign Het
Pard3b T A 1: 62,159,511 C253S possibly damaging Het
Pclo T C 5: 14,677,214 S2029P unknown Het
Plekhg3 A G 12: 76,565,569 I401M probably damaging Het
Polg A T 7: 79,450,644 C1140S probably benign Het
Prl7c1 A T 13: 27,778,834 L62H probably damaging Het
Psmf1 T A 2: 151,734,243 E115V probably benign Het
Ptpn9 A T 9: 57,056,726 N381I possibly damaging Het
Pzp A G 6: 128,489,016 S1234P probably benign Het
Qrich1 A G 9: 108,559,286 T728A possibly damaging Het
Ralgps2 C A 1: 156,829,066 A323S probably benign Het
Rimbp3 T C 16: 17,211,046 V778A possibly damaging Het
Scn1a A T 2: 66,286,005 L430* probably null Het
Sema7a A T 9: 57,955,080 I189F probably damaging Het
Slc22a8 T C 19: 8,594,022 I39T probably benign Het
Stap2 T C 17: 56,002,023 T115A probably benign Het
Stmn4 A G 14: 66,357,939 I138V probably benign Het
Suds3 C T 5: 117,098,270 probably null Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tet1 A C 10: 62,879,046 D323E probably benign Het
Tia1 A G 6: 86,424,365 D140G probably damaging Het
Trio C T 15: 27,851,924 R827H possibly damaging Het
Ttn A G 2: 76,795,053 probably null Het
Unc80 T C 1: 66,510,707 V708A probably benign Het
Vmn1r194 A T 13: 22,244,602 T130S probably benign Het
Wfikkn2 A G 11: 94,238,929 C129R probably damaging Het
Zkscan5 A C 5: 145,220,866 H726P probably damaging Het
Other mutations in Hvcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Hvcn1 APN 5 122238471 missense probably benign 0.00
IGL01383:Hvcn1 APN 5 122237703 missense probably damaging 0.99
R0515:Hvcn1 UTSW 5 122233519 missense probably damaging 1.00
R0523:Hvcn1 UTSW 5 122216365 critical splice donor site probably null
R5068:Hvcn1 UTSW 5 122233481 missense probably damaging 1.00
R5438:Hvcn1 UTSW 5 122238464 missense probably damaging 1.00
R7178:Hvcn1 UTSW 5 122233510 missense probably damaging 1.00
R7404:Hvcn1 UTSW 5 122237685 missense probably damaging 1.00
R7634:Hvcn1 UTSW 5 122233523 missense probably damaging 1.00
V5622:Hvcn1 UTSW 5 122233539 intron probably benign
V5622:Hvcn1 UTSW 5 122233539 intron probably benign
Predicted Primers PCR Primer
(F):5'- CATGAGCTTTGCCATCCTGG -3'
(R):5'- CTAGAGGTAACACTCGTCACCAG -3'

Sequencing Primer
(F):5'- CATCCTGGTCTTCTTCATGTTGGAG -3'
(R):5'- ACCAGATACTACCATCCTACGTTTC -3'
Posted On2019-12-20